171,035 results
-
Plasmid#236890PurposeExpress CFTR WT HiBiT in Mammalian Cells under a CMV promoterDepositorAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pEGFP-C1-G3BP1-WT
Plasmid#135997PurposeWT G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cellsDepositorAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX-TRE-dCas9-KRAB-MeCP2-BSD
Plasmid#140690PurposeInducible knockdown of gene expression in human cells for pooled scRNA-seq experimentsDepositorInsertCas9m4-KRAB-MeCP2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLTR-RD114A
Plasmid#17576DepositorInsertRD114 envelope glycoprotein
UseLentiviralExpressionMammalianAvailable SinceApril 14, 2008AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PEmax-P2A-hMLH1dn
Plasmid#174828PurposeMammalian expression of SpCas9 PEmax prime editor with P2A-human MLH1dn (codon optimized)DepositorInsertPEmax-P2A-hMLH1dn
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianMutationDetailed in manuscript; deletion of residues 754-…PromoterCMVAvailable SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDx_mScarlet-I3
Plasmid#189757PurposeDual expression vector for bacteria and mammalian cells producing mScarlet-I3 red fluorescent proteinDepositorInsertmScarlet-I3
Tags6xHisExpressionBacterial and MammalianPromoterCMV & RhaAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2/5
Plasmid#232922PurposeAAV packaging plasmid expressing AAV2 Rep protein and AAV5 capsid proteinDepositorInsertRep2/Cap5
UseAAVExpressionMammalianAvailable SinceSept. 17, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL3 Basic Vector
Plasmid#212936PurposeFirefly luciferase vector for investigating regions controlling transcriptionDepositorTypeEmpty backboneUseLuciferaseMutationWTAvailable SinceJan. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits