We narrowed to 426 results for: AAVS1
-
Plasmid#136934Purposedonor plasmid for constitutive FUCCI expression in human cellsDepositorInsertClover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)
UseSynthetic BiologyTagsClover and mKO2ExpressionMammalianPromoterCAGAvailable SinceApril 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 hPGK-PuroR-pA donor
Plasmid#22072DepositorInsertPGK-Puro (PGK1 Human)
UseZfn donorAvailable SinceOct. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro Xlone-eGFP
Plasmid#136936Purposedonor plasmid for inducible transgene expression in human cellsDepositorInsertall-in-one tet-on system
UseSynthetic BiologyExpressionMammalianPromoterTRE3GSAvailable SinceApril 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-SA-2A-NEO-CAG-RTTA3
Plasmid#60431Purposeneomycin resistance; constitutive promoter driving reverse tet activatorDepositorInsertrtTA3
UseZfn donorPromoterCAGAvailable SinceFeb. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro
Plasmid#227266PurposeEmpty AAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter. A CDS can be cloned adjacent to the promoter via restriction or gibson cloning using the MluI cut site.DepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Puro-CAG-mNG2(1-10)
Plasmid#206042PurposeRepair template for the integration of a mNG2(1-10) expression cassette into the AAVS1 locus in human cells.DepositorInsertAAVS1 homology arms with SA-P2A-Puro marker and CAG-mNG2(1-10) expression cassette
UseCRISPR and Synthetic Biology; Donor templateExpressionMammalianAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NFIA+SOX9
Plasmid#129455PurposeInducible overexpression of NFIA and Sox9 in human cells.DepositorAvailable SinceMarch 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TetOn-dCas9-KRAB
Plasmid#115545PurposeDoxycycline inducible dCas9-KRAB targeting construct for AAVS1 locusDepositorTypeEmpty backboneTagsHAExpressionBacterial and MammalianPromoterCAGAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
hAAVS1-gs4_EF1a-Cas9-2A-GFP
Plasmid#118414PurposeCRISPR knockout, expresses Cas9, and sgRNA targeting AAVS1 locusDepositorAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TRE-MA4-GFP
Plasmid#114380PurposeDoxycycline inducible MLL-AF4 and GFP expression. The construct has been used with CAG-rtTA for making engraftable iPSC derived HSCs.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TLR targeting vector
Plasmid#64215PurposeTargeting vector for the human AAVS1 locus for insertion of traffic light reporter (TLR) constructDepositorInserttraffic light reporter (TLR) (AAVS1 Human)
UseHuman targetingMutationsee publication for detailsPromoterCAGAvailable SinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-p62 HRD
Plasmid#207550PurposeHomologous recombination donor to integrate and expression cassette for eGFP-p62 in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-P62
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-LC3B HRD
Plasmid#207551PurposeHomologous recombination donor to integrate and expression cassette for eGFP-LC3B in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-LC3B
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 EGFP-GABARAPL1 HRD
Plasmid#207552PurposeHomologous recombination donor to integrate and expression cassette for EGFP-GABRAPL1 in the AAVS1 locus of human cellsDepositorInsertTET inducible EGFP-GABARAPL1
TagsEGFPExpressionMammalianPromoterEndogenousAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-42:AAVS1-mTagRFPT-CAAX
Plasmid#107580PurposeHomology arms, promoter and linker-mTagRFPT-CAAX sequence for internal insertion of CAGGS-driven mTagRFPT-CAAX at the AAVS1 safe harbor location in human cellsDepositorInsertAAVS1 Homology Arms with CAGGS-driven mTagRFPT-CAAX (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 9, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSL5069 (pDonor(AAVS1),CRISPR_Pse)
Plasmid#200904PurposeEncodes a mini-transposon derived from Pseudoalteromonas Tn7016 with a splice acceptor-T2A-PuroR-T2A-eGFP cargo, and a CRISPR RNA under a U6 promoter. Total transposon size = 2,024 bp.DepositorInsertMini Tn7016 (AAVS1 NGS), PseCRISPR (tSL425)
ExpressionMammalianAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Puro
Plasmid#227269PurposeEmpty AAVS1 targeting donor for the insertion of Puro and a medium strength PGK promoter. A CDS can be cloned adjacent to the promoter via restriction or gibson cloning using the MluI cut site.DepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-36: AAVS1-mEGFP (PGK)
Plasmid#114404PurposeHomology arms and linker-mEGFP sequence for internal insertion of PGK-mEGFP at the AAVS1 safe harbor location in human cells as a reporter for cytoplasmic mEGFPDepositorInsertAAVS1 Homology Arms with PGK driven mEGFP (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 4, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAVS1 SA-2A-puro-pA_hSYN1_dTomato-SV40pA
Plasmid#196192Purposehuman synapsin promoter driven dTomato expression at human AAVS1 safe harbour locusDepositorInsert2xCHS4_hSYN1_INTRON_dTomato-WPRE-SV40-2xCHS4
UseZnf donorAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only