We narrowed to 3,313 results for: phage
-
Plasmid#248952Purposephage lambda large terminase subunit under control of a crystal violet inducible promoterDepositorInsertlambdaterminase
ExpressionBacterialAvailable SinceFeb. 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6c
Plasmid#207853PurposeMammalian expression of PE6c prime editorDepositorInsertPE6c
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationTf1rt(P70T, G72V, S87G, M102I, K106R, K118R, I128…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
NINJA TC
Plasmid#159274PurposeExpresses the NINJA targeting construct (inducible neoantigen expression via cumulative Cre, rtTA, doxycycline and tamoxifen).DepositorInsertNINJA TC
UseMouse TargetingExpressionMammalianAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pARC8-LambdaRedBeta-EcSSB-EcMutLE32K
Plasmid#162576PurposeArabinose inducible recombineering plasmid encoding Lambda-Red Beta with EcSSB for use with dsDNA templates and enhanced recombination efficiency. Contains a dominant negative mismatch repair protein.DepositorInsertsLambda Red-Beta
E. coli SSB
EcMutLE32K
ExpressionBacterialMutationE32K mutated to give dominant negative phenotypePromoterpBADAvailable SinceMay 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCSCRET2(#323)
Plasmid#184058Purposecyclofen-inducible CRE activation via mammalian cell transfection or mRNA synthesisDepositorInsert6myc-CRE-ERT2
UseSynthetic BiologyTags6xMycExpressionMammalianMutationERT2: G400V, M543A, L544A, deleted 1-281;PromotersCMV+SP6Available SinceJuly 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pZB246-T7-T+
Plasmid#250903PurposeExpresses N-terminal His-tag thermally stabilized T7 RNAP under a lac-inducible promoter on Kanamycin Resistance BackboneDepositorInsertThermally Stable T7 RNA Polymerase
Tags6xHisExpressionBacterialMutationArginine 31 to Aspartic Acid, Alanine 61 to Argin…PromoterpT5-lacUVAvailable SinceFeb. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pUC18T-mini-Tn7T-Gm-CC
Plasmid#246943PurposePlasmid strain containing pUC18T-mini-Tn7T-Gm-CC01 plasmid, which will insert a nonsense spacer version of the synthetic CRISPR-Cas system from P. aeruginosa PA14 into the genome at the att-Tn7 site.DepositorInsertType IF CRISPR-Cas system from Pseudomonas aeruginosa PA14
UseSynthetic BiologyExpressionBacterialPromoterNative promoters from PA14Available SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
UbC NLS-HA-MCP-YFP
Plasmid#31230DepositorInsertNLS-HA-MCP-YFP
UseLentiviralExpressionMammalianAvailable SinceSept. 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET29b(+)_gp1(A11V)
Plasmid#225131PurposePhage GIL01 protein gp1 (A11V) mutant with a single nucleotide substitution (C32T)DepositorInsertgp1 (A11V)
TagsHis-tagExpressionBacterialMutationAlanine 11 to ValinePromoterT7 promoterAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPSU2
Plasmid#89566PurposeHigh copy number plasmid 2 to prepare Penn State DNA molecular weight laddersDepositorInserts750 bp EcoRV fragment
3000 bp EcoRV fragment
4000 bp EcoRV fragment
50 bp PstI fragment
100 bp PstI fragment
200 bp PstI fragment
300 bp PstI fragment
400 bp PstI fragment
500 bp PstI fragment
600 bp PstI fragment
1500 bp Psti fragment
4100 bp PstI fragment
ExpressionBacterialAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28a-gp32-H6
Plasmid#163912PurposeExpresses T4 gp32 for bacterial expression and affinity purificationDepositorInsertgp32
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-uvsX-H6
Plasmid#163913PurposeExpresses uvsX for bacterial expression and affinity purificationDepositorInsertuvsX
TagsHisExpressionBacterialPromoterT7 promoterAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-DreO-bGHpA
Plasmid#50363PurposeCan be used to generate AAV virus that will express DreO recombinase in neurons from the synapsin promoterDepositorHas ServiceAAV Retrograde and AAV5InsertDreO recombinase
UseAAVTagsnoneMutationSequence optimized for expression in mammalian ce…PromoterhSyn1Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.SFFV.Cre.IRES.dTomato
Plasmid#187192PurposeLentiviral overexpression of Cre recombinaseDepositorInsertCre recombinase (cre Escherichia phage P1 (isolate: mod749::IS5 c1.100 mutant, nat-host: Escherichia coli))
UseLentiviralAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL2787
Plasmid#15460DepositorInsertphage phi11 int gene
ExpressionBacterialAvailable SinceOct. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET28a(+)v2_TwinStrep-SUMO-φC31(PhiC31)-8xHis
Plasmid#246982PurposeExpresses E. coli codon-optimized TwinStrep-SUMO-tagged φC31(PhiC31) integrase with N- and C-terminal NLS, using an improved pET design from Shilling et al. 2020.DepositorInsertφC31(PhiC31)
UseSynthetic BiologyTags8xHis, Nucleoplasmin, SUMO, SV40, and TwinStrepExpressionBacterialPromoterT7Available SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
anti-Desmin_D7-pBIOCAM5
Plasmid#39346DepositorInsertscFv-Fc-fusion specific for Desmin (clone D7) (DES Human)
Tags3xFLAG, 6xHis, and human FcExpressionMammalianAvailable SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a-MH6-uvsY
Plasmid#163914PurposeExpresses uvsY for bacterial expression and affinity purificationDepositorAvailable SinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only