We narrowed to 11,750 results for: ARIA;
-
Plasmid#139989PurposeCMV and T7 promoter expression plasmid for human codon optimized SpRY(A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpRY with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N131…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pSPL3-ABCC8-2
Plasmid#135916PurposeEncodes ABCC8 exon 2 wild type for the analysis of splicing variantsDepositorInsertATP-binding Cassette subfamily C member 8 (ABCC8 Human)
UseExon trappingExpressionMammalianPromoterSV40Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPL3-ABCC8-9-10
Plasmid#135918PurposeEncodes ABCC8 exons 9 and 10 wild type for the analysis of splicing variantsDepositorInsertATP-binding Cassette subfamily C member 8 (ABCC8 Human)
UseExon trappingExpressionMammalianPromoterSV40Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-CD20-Puro
Plasmid#209757PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 3 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSPL3-ABCC8-27
Plasmid#135919PurposeEncodes ABCC8 exon 27 wild type for the analysis of splicing variantsDepositorInsertATP-binding Cassette subfamily C member 8 (ABCC8 Human)
UseExon trappingExpressionMammalianPromoterSV40Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-CD20-Puro
Plasmid#209755PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 1 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-CD20-Puro
Plasmid#209756PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 2 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpRY-P2A-EGFP (RTW5025)
Plasmid#140003PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpRY(D10A/A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpRY with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpRY=A61R/L1111R/D1135L/S1136W/G121…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpRY-HF1-P2A-EGFP (RTW5008)
Plasmid#139997PurposeCMV and T7 promoter expression plasmid for human codon optimized SpRY-HF1(SpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R;HF1=N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpRY-HF1 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpRY=A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N131…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpG-HF1-P2A-EGFP (RTW5000)
Plasmid#139996PurposeCMV and T7 promoter expression plasmid for human codon optimized SpG-HF1(SpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R;HF1=N497A/R661A/Q695A/Q926A) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpG-HF1 with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R; HF…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.1.7
Plasmid#171747PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-B.1.1.7 variant (UK)DepositorInsertSpike (S-GSAS-B.1.1.7 variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.617.2-AVI
Plasmid#176334PurposeExpresses SARS-CoV-2 S2P protein from the B.1.617.2 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.617.2 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT19R, G142D, del156-157, R158G, L452R, T478K, D61…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-BA.2-AVI
Plasmid#184533PurposeExpresses SARS-CoV-2 RBD domain from the BA.2 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-BA.2 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG339D, S371F, S373P, S375F, T376A, D405N, R408S, …Available SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
R713-M50-303: CMV51p> Halotag-HRasHVR
Plasmid#159685PurposeMammalian protein expression of HRAS HVR (Hypervariable region)-Halotag fusionDepositorAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
R713-M48-303: CMV51p> Halotag-Kras4aHVR
Plasmid#159684PurposeMammalian protein expression of KRAS4a HVR (Hypervariable region)-Halotag fusionDepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
R703-M80-303: CMV51p> Halotag-Kras4bHVR
Plasmid#159683PurposeMammalian protein expression of KRAS4b HVR (Hypervariable region)-Halotag fusionDepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
R713-M52-303: CMV51p> Halotag-NRasHVR
Plasmid#159686PurposeMammalian protein expression of NRAS HVR (Hypervariable region)-Halotag fusionDepositorAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.1.7-AVI
Plasmid#176325PurposeExpresses SARS-CoV-2 S2P protein from the B.1.1.7 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.1.7 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutation69-70 del, 144del, N501Y, A570D, D614G, P681H, T7…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRRL-MND-hCard11 R72L-T2A-GFP
Plasmid#163784PurposeExpression of R72L CARD domain variantDepositorAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-BA.2-AVI
Plasmid#184532PurposeExpresses SARS-CoV-2 NTD domain from the BA.2 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-BA.2 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT19I, L24-, P25-, P26-, A27S, G142D, V213GAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.351-AVI
Plasmid#176326PurposeExpresses SARS-CoV-2 S2P protein from the B.1.351 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.351 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, D80A, D215G, 242-244del, R246I, K417N, E484…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-P.1-AVI
Plasmid#176429PurposeExpresses SARS-CoV-2 NTD domain from the P.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-P.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, T20N, P26S, D138Y, R190SAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-P.1-AVI
Plasmid#176327PurposeExpresses SARS-CoV-2 S2P protein from the P.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-P.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, T20N, P26S, D138Y, R190S, K417T, E484K, N50…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-B.1.351
Plasmid#171749PurposeMammalian expression of SARS-CoV-2 Spike protein S-GSAS-D614G-B.1.351 variant (South African)DepositorInsertSpike (S-GSAS-B.1.351 variant) (S Severe acute respiratory syndrome coronavirus 2)
TagsHRV3C cleavage site, 8X His tag, 2X Strep-Tag IIExpressionMammalianMutationEctodomain (AAs 1-1208); 682-685 (furin site = RR…Available SinceJuly 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiX-(loxPcon-TET-DIAL-YB-TATA)-mCherry-HRasG12V-bGH-EFS-rtTA-TagBFP-WPRE
Plasmid#246367PurposeloxPcon TET-DIAL Reporter Lentivirus with YB_TATA expressing mCherry-HRasG12V in the presence of DOX and rtTA and editable by Cre recombinase. Contains rtTA-TagBFP expressed divergenty.DepositorAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-BJ.1-AVI
Plasmid#196617PurposeExpresses SARS-CoV-2 RBD protein from the BJ.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-BJ.1
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG339H, R346T, L368I, S371F, S373P, S375F, T376A, …Available SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-C.37-AVI
Plasmid#181702PurposeExpresses SARS-CoV-2 RBD-SD1 domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-C.37 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL452Q, F490SAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-B.1.621-AVI
Plasmid#181703PurposeExpresses SARS-CoV-2 RBD-SD1 domain from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-B.1.621 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationR346K, E484K, N501YAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.621-AVI
Plasmid#181694PurposeExpresses SARS-CoV-2 S2P protein from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.621 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, insert144T, Y144S, Y145N, R346K, E484K, N50…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-C.37-AVI
Plasmid#181696PurposeExpresses SARS-CoV-2 NTD domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-C.37 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG75V, T76I, R246N, ∆S247-∆D253,Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.621-AVI
Plasmid#181697PurposeExpresses SARS-CoV-2 NTD domain from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.621 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, insert144T, Y144S, Y145NAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-C.37-AVI
Plasmid#181699PurposeExpresses SARS-CoV-2 RBD domain from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-C.37 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL452Q, F490SAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-B.1.621-AVI
Plasmid#181700PurposeExpresses SARS-CoV-2 RBD domain from the B.1.621 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-B.1.621 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationR346K, E484K, N501YAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-C.37-AVI
Plasmid#181693PurposeExpresses SARS-CoV-2 S2P protein from the C.37 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-C.37 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG75V, T76I, R246N, ∆S247-∆D253, L452Q, F490S, D61…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.617.1-AVI
Plasmid#176435PurposeExpresses SARS-CoV-2 NTD domain from the B.1.617.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.617.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, G142D, E154KAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.617.2-AVI
Plasmid#176436PurposeExpresses SARS-CoV-2 NTD domain from the B.1.617.2 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.617.2 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT19R, G142D, E156del, F157del, R158GAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-AY.1-AVI
Plasmid#176437PurposeExpresses SARS-CoV-2 NTD domain from the AY.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-AY.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT19R, T95I, G142D, del156-157, R158G, W258LAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.618-AVI
Plasmid#176438PurposeExpresses SARS-CoV-2 NTD domain from the B.1.618 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.618 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationY145del, H146delAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-AY.1-AVI
Plasmid#176335PurposeExpresses SARS-CoV-2 S2P protein from the AY.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-AY.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT19R, T95I, G142D, del156-157, R158G, W258L, K417…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.618-AVI
Plasmid#176336PurposeExpresses SARS-CoV-2 S2P protein from the B.1.618 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.618 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationY145del, H146del, E484K, D614GAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.1.7-AVI
Plasmid#176424PurposeExpresses SARS-CoV-2 NTD domain from the B.1.1.7 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.1.7 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutation69-70 del, 144delAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.351-AVI
Plasmid#176426PurposeExpresses SARS-CoV-2 NTD domain from the B.1.351 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.351 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationL18F, D80A, D215G, 242-244del, R246IAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.429-AVI
Plasmid#176328PurposeExpresses SARS-CoV-2 S2P protein from the B.1.429 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.429 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationW152C, L452R, D614GAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.526-S477N-AVI
Plasmid#176329PurposeExpresses SARS-CoV-2 S2P protein from the B.1.526 variant containing S477N mutation with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.429 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, D253G, S477N, D614G, A701VAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.526-E484K-AVI
Plasmid#176330PurposeExpresses SARS-CoV-2 S2P protein from the B.1.526 variant containing E484K mutation with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.429 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, D253G, E484K, D614G, A701VAvailable SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-B.1.617.1-AVI
Plasmid#176333PurposeExpresses SARS-CoV-2 S2P protein from the B.1.617.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-B.1.617.1 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT95I, G142D, E154K, L452R, E484Q, D614G, P681R, Q…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only