We narrowed to 4,521 results for: GCA;
-
Plasmid#90682Purpose3rd generation lentiviral gRNA plasmid targeting human ESPL1DepositorInsertESPL1 (Guide Designation D7.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
GINS1 D11.1 gRNA
Plasmid#90694Purpose3rd generation lentiviral gRNA plasmid targeting human GINS1DepositorInsertGINS1 (Guide Designation D11.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_MIER3_2
Plasmid#86324PurposeEncodes gRNA for 3' target of human MIER3DepositorInsertgRNA against MIER3 (MIER3 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_1
Plasmid#86321PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_1
Plasmid#86314PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-ATF7IPi2
Plasmid#59615PurposeExpression of shRNA against human ATF7IPDepositorAvailable SinceOct. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
CS2 luc MutA
Plasmid#13498DepositorInsertFstl1 (Fstl1 Mouse)
UseLuciferaseMutationcontains 3 tandem copies of the following sequenc…Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
CS2 luc MutB
Plasmid#13499DepositorInsertFstl1 (Fstl1 Mouse)
UseLuciferaseMutationcontains 3 tandem copies of the following sequenc…Available SinceDec. 29, 2006AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'GAC)
Plasmid#170127PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a GAC at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'GAC)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (3'GAC)
Plasmid#170129PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a GAC at the 3' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(3'GAC)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR-SNRPA-sgRNA1
Plasmid#165947PurposeCRISPR-mediated gene perturbation (knock-out) of SNRPADepositorArticleAvailabilityAcademic Institutions and Nonprofits only -
CMV-R-GECO1
Plasmid#32444PurposeMammalian expression of Red fluorescent genetically encoded Ca2+ indicator for optical imagingDepositorInsertR-GECO1.0
ExpressionMammalianMutationSubstitutions relative to the mApple-derived anal…PromoterCMVAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDL560
Plasmid#231161PurposeT-DNA encoding TRV2 with ipt and mobile gRNA targeting SlPDSDepositorInsertipt and mobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL691
Plasmid#231166PurposeT-DNA encoding TRV2 with ipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESSDepositorInsertipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9nucl-T2A-mCherry - BAKgRNA1- BAKgRNA2
Plasmid#167295PurposePlasmid encoding for 2 gRNAs targeting the human BAK gene and a CMV driven nuclease Cas9 followed by self-cleaving mCherryDepositorInsertBAK (BAK1 Human)
ExpressionMammalianAvailable SinceApril 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a6
Plasmid#124847PurposeMutagenesis of Slc17a6 with SauCas9DepositorInsertSlc17a6 gRNA (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330A-nBRD4/PITCh
Plasmid#91794PurposePITCh sgRNA, N-terminal BRD4 sgRNA, and Cas9 expressing plasmid for use with the dTAG knock-in system and BRD4DepositorInsertSpCas9
UseCRISPRExpressionMammalianPromoterchicken β-actin promoterAvailable SinceMarch 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-TBK1-gRNA (PX459)
Plasmid#221550PurposeExpresses Cas9 and gRNA for disruption of TBK1 gene in human cellsDepositorAvailable SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-FLEX-NEPLDCV-P2A-mRUBY3-WPRE
Plasmid#207664PurposeNeuropeptide degradationDepositorInsertNEP (MME Human)
UseAAV and Cre/LoxTagsmRUBY3MutationAddition of signaling peptide (POMC) on the N-ter…PromoterhSynapsinAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-GFP KI
Plasmid#131497PurposeEndogenous tagging of β3 Tubulin: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Anillin
Plasmid#68027PurposeFull length Anillin rendered RNAi-resistant) in mammalian expression vector pEGFP-C1DepositorInsertAnillin (ANLN Human)
TagseGFPExpressionMammalianMutationsilent mutations at 798 5'-TGCC TCTTTGAATAAA…PromoterCMVAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMV-NLS-R-GECO
Plasmid#32462PurposeMammalian expression of nucleus-targeting red fluorescent genetically encoded Ca2+ indicator for optical imagingDepositorInsertR-GECO1.0
TagsNLS sequence DPKKKRKVExpressionMammalianMutationSubstitutions relative to the mApple-derived anal…PromoterCMVAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-CTRLg1
Plasmid#139450PurposeLentiviral vector with non-targeting gRNA and neomycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-MATR3-ts2
Plasmid#174272PurposeMATR3 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-MATR3-ts3
Plasmid#174273PurposeMATR3 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg2
Plasmid#124857PurposeMutagenesis of Gabrg2DepositorInsertGabrg2 (Gabrg2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
POLR2A-N CRISPR pX330
Plasmid#124495PurposeA CRISPR plasmid for targeting the N-terminus coding region of human POLR2ADepositorInsertPOLR2A targeting CRISPR
UseCRISPRPromoterU6 promoterAvailable SinceApril 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459-TP53-exon5
Plasmid#217456PurposeFor TP53 knockout targeting exon 5 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SLC31A1_sg1
Plasmid#244869PurposeKnockout of human SLC31A1DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only