We narrowed to 234 results for: G1
-
Plasmid#64736PurposeYeast expression plasmidDepositorTypeEmpty backboneExpressionYeastAvailable SinceJune 1, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMA-SpCas9-g1
Plasmid#80784PurposeBsaI-based cloning of SpCas9 gRNA guide sequence, position 1/11/21 in the arrayDepositorInsertCRISPR gRNA expression cassette (for SpCas9)
UseCRISPRTagsnaExpressionMammalianPromoterU6Available SinceSept. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G1-Km
Plasmid#46813PurposeTEF1 and PGK1 promoter controlled expression cassettes with G418 resistance for yeast transformationDepositorTypeEmpty backboneTagsFLAG and c-mycExpressionYeastPromoterTEF1 and PGK1Available SinceOct. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS_FLAG-G1 PylRS
Plasmid#154763Purposeplasmid with G1 PylRS for amber suppression in transient or stable, piggybac-mediated, integrationDepositorInsertG1 PylRS (MJ_RS07805 methanogenic archaeon mixed culture ISO4-G1)
TagsFLAGExpressionMammalianPromoterEF1Available SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
ACE2 g1 + Cas9
Plasmid#153011PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEV-G1-Ph
Plasmid#46814PurposeTEF1 and PGK1 promoter controlled expression cassettes with phleomycin resistance for yeast transformationDepositorTypeEmpty backboneTagsFLAG and c-mycExpressionYeastPromoterTEF1 and PGK1Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
ND4 DdCBE G1
Plasmid#221978PurposeExpresses mitochondrial cytosine base editor arm in mammalian cellsDepositorInsertCOX8A MTS-3xFLAG-TALE NT-T-ND4 TALE G1 repeats-TALE CTD-DddAtox 1397C-UGI-ATP5B 3'UTR
UseCRISPRTags3xFLAGExpressionMammalianPromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
ND4 alphaDdCBE G1
Plasmid#221982PurposeExpresses mitochondrial cytosine base editor arm in mammalian cellsDepositorInsertCOX8A MTS-3xFLAG-TALE NT-alphaN-ND4 TALE G1 repeats-TALE CTD-DddAtox 1397C-UGI-ATP5B 3'UTR
UseCRISPRTags3xFLAGExpressionMammalianMutationTALE: Q231R, W232G, S233APromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX-EGFP-g1
Plasmid#107273PurposeeGFP sgRNA-1 and Cas9 expression vector (aka. pX-ps1)DepositorInsertGFP sgRNA-1
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g1 + Cas9
Plasmid#153015PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorInsertCas9 + TMPRSS2 gRNA
UseCRISPR and LentiviralTagsTagBFP2Available SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
G1S-HA-pCB6
Plasmid#74373PurposeMammalian expression of a G1S mutant HA from the X:31 strain of influenza virusDepositorInsertHA
ExpressionMammalianMutationG1SPromoterCMVAvailable SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATP6 DdCBE G1
Plasmid#221950PurposeExpresses mitochondrial cytosine base editor arm in mammalian cellsDepositorInsertCOX8A MTS-3xFLAG-TALE NT-T-ATP6 TALE G1 repeats-TALE CTD-DddAtox 1397C-UGI-ATP5B 3'UTR
UseCRISPRTags3xFLAGExpressionMammalianPromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATP6 alphaDdCBE G1
Plasmid#221958PurposeExpresses mitochondrial cytosine base editor arm in mammalian cellsDepositorInsertCOX8A MTS-3xFLAG-TALE NT-alphaN-ATP6 TALE G1 repeats-TALE CTD-DddAtox 1397C-UGI-ATP5B 3'UTR
UseCRISPRTags3xFLAGExpressionMammalianMutationTALE: Q231R, W232G, S233APromoterCMVAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g1
Plasmid#120209PurposeCENPB CRISPRi guide RNA 1DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralAvailable SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pARA (pKD-G1)
Plasmid#62680PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP123
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1(7FTrp)RS
Plasmid#177310PurposetRNA synthetase/tRNA pair for the in vivo incorporation of 7-Fluoro-L-Tryptophan (7FTrp) into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1(CysCNP)RS
Plasmid#225054PurposetRNA synthetase/tRNA pair for the incorporation of S-(4-cyanopyridin-2-yl)-L-cysteine (CysCNP) and S-(4-cyanopyrimidin-2-yl)-L-cysteine (CysCNPym) into proteins in response to the amber (TAG) codonDepositorArticleInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1(5CNW)RS
Plasmid#222872PurposetRNA synthetase/tRNA pair for the in vivo incorporation of 5-Cyano-L-Tryptophan (5-CN-Trp) into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1(4CNW)RS
Plasmid#222871PurposetRNA synthetase/tRNA pair for the in vivo incorporation of 4-Cyano-L-Tryptophan (4-CN-Trp) into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only