Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 643 results for: ato

Showing: 1 - 30 of 643 results

  2. Viral Vectors 101: Voltage Indicators

    Type
    Blog Post
    ...Voltage indicators are voltmeters for cells! In this blog we will review how these indicators work, their...fluorescence or voltage indicators.   Viral Vectors and Voltage Indicators As previously mentioned...their use as biological tools. Why Use Voltage Indicators? Electrical signals are integral to many facets...within a cell are genetically encoded voltage indicators (GEVIs) and chemigenetic sensors. These tools...describe in more detail below. Types of Voltage Indicators GEVIs can be divided up structurally into 2 main...structurally separates the two components of the indicator, which can make the kinetics of voltage sensing...Factors like photobleaching, lack of red-shifted indicators, and brightness of fluorescence all have room...

  3. New Norepinephrine Indicators: nLightG and nLightR

    Type
    Blog Post
    ...Neuromodulators like dopamine and norepinephrine have important functions in the brain but have been ...developing and depositing two new norepinephrine indicators: nLightG and nLightR (Kagiampaki et al., 2023...White insets indicate surface expression of the indicators over white dashed lines. Scale bars, 10 μm (HEK293T...trialed in two-photon in vivo experiments. nLight indicators are more sensitive to and selective for norepinephrine...They can, however, be studied with the nLight indicators. Speed One of the major advantages of this next...… Patriarchi, T. (2023). Sensitive multicolor indicators for monitoring norepinephrine in vivo. Nature...

  4. Plasmids 101: Terminators and PolyA signals

    Type
    Blog Post
    ...plasmids use Rho-independent terminators, which include naturally occurring terminators, such as T7 and rrnB,...engineered terminators come close (>95%). For most purposes, however, any common terminator will suffice...double terminators to reduce unwanted translation of downstream elements. A high affinity terminator may ...of yeast terminators of varying strength. A discussion of the effects of various terminators in the context...termination and polyadenylation? The role of the terminator, a sequence-based element, is to define the end...synthesized RNA from the transcription machinery. Terminators are found downstream of the gene to be transcribed...transcribed, and typically occur directly after any 3’ regulatory elements, such as the polyadenylation or poly...

  7. PEI Calculator for Planning AAV Packaging Transfections

    Type
    Blog Post
    ... download the PEI calculator for AAV packaging Use the PEI transfection calculator for AAV packaging ...corresponding column in the calculator spreadsheet: We hope that this calculator will make it easier to plan...for AAV packaging, considering using this PEI Calculator. AAV packaging typically requires transfecting...right, you need to do a few calculations. This calculator can do the math for you and it’s simple to make...whole experiment And here’s the equation the calculator uses to give you the μl needed of each plasmid...experiments. Let us know what you think about the calculator in the comments section below. References 1.... transfection calculator...

  9. Pairing CombiGEM and CRISPR for Combinatorial Genetic Screening

    Type
    Blog Post
    ... an easy-to-use tool to analyze the complex combinatorial genetic networks underlying your favorite biological...screening are vastly useful for mapping the combinatorial genetics that underlie complex regulation in...barcoded gRNA libraries that can be used to combinatorially modify the genome, screen for a particular ...successfully applied to functionally characterize combinatorial gene knockouts generated via multiplexed gRNA...expression (Wong et al., 2016), in addition to the combinatorial expression of other genetic elements including... Figure 2: Strategy for assembling barcoded combinatorial gRNA libraries. (Adapted from Wong et al., 2016...antibiotic-resistant bacteria enabled by massively parallel combinatorial genetics." Proceedings of the National Academy...

  10. Enabling high school research at the Journal of Emerging Investigators

    Type
    Blog Post
    ...we introduce you to the Journal of Emerging Investigators, an open-access journal that enables high school... the interview with the Journal of Emerging Investigators Podcast breakdown Intro Chapter 1 - Introduction...Olivia Ho-Shing, and the Journal of Emerging Investigators. Chapter 2 - Getting high school students and...

  11. Enabling Precision Functional Genomics with the Target Accelerator Plasmid Collection

    Type
    Blog Post
    ... plasmid toolkit, the Broad Institute Target Accelerator Plasmid Collection, that we hope researchers ... For many years, we’ve hoped that large scale laboratory-based functional experiments that classify which...and cancer phenotypes. Broad Institute Target Accelerator Plasmid Collections To overcome this first challenge..., we’ve developed the Broad Institute Target Accelerator Plasmid Collections, now widely available to ...Collection). In addition, we worked with many collaborators to aggregate a sequence-confirmed series of ...

  13. Q&A with Karen Katz and Carl Paratore, the Newest Members of the Addgene Board of Directors

    Type
    Blog Post
    ...School and Paratore is the General Auditor at Tufts Health Plan. The addition of Katz and Paratore onto the...Interactive. Learn more about Carl Paratore, MBA, CPA Mr. Paratore serves as the General Auditor at Tufts...re excited to welcome Karen Katz, Esq and Carl Paratore, MBA, CPA to the Addgene Board of Directors. Katz...that Addgene was looking for new board members. Paratore: Kristen Darby, who’s also a board member, reached...necessary information that’s required to do research. Paratore: What I’ve been most impressed with is the level...potentially also be very helpful to the scientific community.Paratore: I’ve certainly had a front row seat watching...be, an interesting legal and professional challenge.Paratore: The promise there is the ability share the...

  14. CRISPR Activators: A Comparison Between dCas9-VP64, SAM, SunTag, VPR, and More!

    Type
    Blog Post
    ...potent transcriptional activators (p65 and Rta). These transcriptional activators work in tandem to recruit...CRISPRa methods vary in their transcriptional activators: some methods rely on fusion proteins while others...generally thought of as the “first generation” CRISPR activator. While it requires a relatively simple construct...modest gene activation. Synergistic Activation Mediator (SAM) Description SAM uses specially engineered...levels of gene activation compared to other CRISPR activators, making it a popular method for gene activation... SunTag performs better than first generation activators while showing lower activation levels than SAM...transcription. This complex consists of the VP64 activator used in other CRISPR activation methods, as well...

  16. Caltech Systemic Capsids

    Type
    Collection
    ...BiLAMP5e3 dTomato/nlsdTomato Control Fishell 213936 pAAV_BiPVe4_dTomato_nlsdTomato BiPVe4 dTomato/nlsdTomato...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...dTom-nlsdTom E2 regulatory element dTomato Control Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element...Control AIBS , Ting 213814 pAAV_BiSSTe10_dTomato_nlsdTomato BiSSTe10 dTomato/nlsdTomato Control Fishell 213829...213829 pAAV_BiCHATe27_dTomato_nlsdTomato BiCHATe27 dTomato/nlsdTomato Control Fishell 213855 pAAV_BiVIPe4...BiVIPe4 dTomato/nlsdTomato Control Fishell 213914 pAAV_BiLAMP5e3_dTomato_nlsdTomato_nlsdTomato BiLAMP5e3...Control Fishell 213940 pAAV_BiPVe3_dTomato_nlsdTomato BiPVe3 dTomato/nlsdTomato Control Fishell 213944...

  17. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Calcium Indicators (Constitutive or Cre-dependent) jGCaMP8 Fast Genetically Encoded Calcium Indicators. Janelia...calcium indicators for optical imaging (GECOs), including blue, green, red, and ratiometric indicators An ...calcium indicator for fluorescence using HaloTag ligands A modular chemigenetic calcium indicator enables...fluorescence indicator of K+ for optical imaging (GINKO) Genetically encoded fluorescent indicators for imaging...Multicolor palette of ATP indicators (MaLion) RGB-color intensiometric indicators visualize spatiotemporal...fluorescent cAMP indicator (Flamindo2) Genetically-encoded yellow fluorescent cAMP indicator with an expanded...protein-based cAMP indicator (Pink Flamindo) Red fluorescent protein-based cAMP indicator applicable to optogenetics...

  18. Brain Initiative Collection

    Type
    Collection
    ...83894-AAV1 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV2 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV5 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAV9 pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83894-AAVrg pAAV-hDlx-Flex-dTomato-Fishell_7 Cre recombinase-dependent dTomato expression in forebrain GABA-ergic...83896-AAV1 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 Gi-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic...83896-AAV9 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 Gi-DREADD (P2A) nuclear dTomato expression in forebrain GABA-ergic...

  19. Retrograde AAV viral preps

    Type
    Collection
    ...-EYFP Syn Activator Optogenetics Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG Activator Optogenetics...Norepinephrine Dopamine Optogenetics Activators Inhibitors Bidirectional DREADDs Activators Inhibitors Other Molecular...Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP ...Flp-dependent Control Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 27056 pAAV-Ef1a-DIO...Control Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP...107738 pAAV-hSyn-Cre-P2A-dTomato Syn Cre expression with simultaneous dTomato expression Recombinases ...AAV-hSyn1-GCaMP6f-P2A-nls-dTomato Syn GCaMP6f and physically separate nuclear dTomato Calcium sensor Ting 51083...

  20. Tetracycline Inducible Expression

    Type
    Collection
    ...generations of transactivators and promoters are generally cross-compatible. Your choice of transactivator, promoter...Vogelstein Transactivators (tTA or rtTA) Find a construct that expresses the transactivator for your tetracycline... the tetracycline repressor protein (TetR) and operator ( tet O, a 19 nucleotide sequence, TCCCTATCAGTGATAGAGA...response element; tTA: tetracycline-controlled transactivator (fusion of TetR with VP16 transcriptional activation...domain); rtTA: reverse tetracycline-controlled transactivator (fusion of mutated TetR with VP16 transcriptional...the Tet-Off system. A tetracycline-controlled transactivator (tTA) was created by fusing TetR with the activation...tetracycline. A new reverse tetracycline-controlled transactivator (rtTA) was created by fusing rTetR with VP16...

  21. Brain Armamentarium

    Type
    Collection
    ...Gradinaru 213944-PHPeB pAAV_BiSSTe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting...Gradinaru 213940-PHPeB pAAV_BiPVe3_dTomato_nlsdTomato AAV construct expressing dTomato driven by PV+ basket...Gradinaru 213936-PHPeB pAAV_BiPVe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by chandelier...213914-PHPeB pAAV_BiLAMP5e3_dTomato_nlsdTomato_nlsdTomato AAV construct expressing dTomato driven by Lamp5...Gradinaru 213855-PHPeB pAAV_BiVIPe4_dTomato_nlsdTomato AAV construct expressing dTomato driven by VIP interneuron-targeting...Gradinaru 213829-PHPeB pAAV_BiCHATe27_dTomato_nlsdTomato AAV construct expressing dTomato driven by cholinergic...Gradinaru 213814-PHPeB pAAV_BiSSTe10_dTomato_nlsdTomato AAV construct expressing dTomato driven by SST interneuron-targeting...

  22. Immunology Research Plasmids and Resources

    Type
    Collection
    ...MGC110940, OPN SST somatostatin SMST SSTR1 somatostatin receptor 1 SRIF-2 SSTR2 somatostatin receptor 2 - SSTR5... IREL RFX5 regulatory factor X, 5 (influences HLA class II expression) - RFXANK regulatory factor X-associated...kinase, regulatory subunit 1 (alpha) GRB1, p85, p85-ALPHA PIK3R2 phosphoinositide-3-kinase, regulatory subunit...PLAU plasminogen activator, urokinase ATF, UPA, URK, u-PA PLAUR plasminogen activator, urokinase receptor...CSH2 chorionic somatomammotropin hormone 2 CS-2, CSB, hCS-B CSHL1 chorionic somatomammotropin hormone-like...HMG1L2 HDGFRP3 hepatoma-derived growth factor, related protein 3 CGI-142, HDGF2 HGF hepatocyte growth factor...MSTN myostatin GDF8 MTNR1A melatonin receptor 1A MEL-1A-R, MT1 MTNR1B melatonin receptor 1B MEL-1B-R, MT2...

  23. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 NOT AVAILABLE YET Cre is coexpressed with tdTomato and Pac (puromycin... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...

  24. Control AAV Preps

    Type
    Collection
    ...AAV9-X1.1 Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-...rg*, PHP.eB Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104...mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,...Deisseroth 135630 pAAV-S5E2-dTom-nlsdTom E2 regulatory dTomato Constitutive 1, 9, PHP.eB Dimidschstein 135631...Deisseroth 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Feng 27056...2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...9, rg* Fishell 83894 pAAV-hDlx-Flex-dTomato-Fishell_7 Dlx dTomato Cre dependent 1, 2, 5, 9, rg* Fishell...

  25. Validated gRNA Sequences

    Type
    Collection
    ...25619936 Sato ASCL1 H. sapiens TGGGCAGCCGCTCGCTGCAGCAG 64130 activate S. pyogenes 25619936 Sato ASCL1 H...25619936 Sato ASCL1 H. sapiens TGGTGTTTATTCAGCCGGGAGTC 64132 activate S. pyogenes 25619936 Sato Asip R....pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC 64157 activate S. pyogenes 25619936 Sato GAL4UAS TGGTCCGTCTAGAAACTCGGTAC...25619936 Sato IL1RN H. sapiens TGGCATCAAGTCAGCCATCAGC 64151 activate S. pyogenes 25619936 Sato IL1RN H....25619936 Sato IL1RN H. sapiens TGGTGTACTCTCTGAGGTGCTC 64140 activate S. pyogenes 25619936 Sato inverted...25619936 Sato MYOD1 H. sapiens TGGGAGGTTTGGAAAGGGCGTGC 64139 activate S. pyogenes 25619936 Sato MYOD1 H...25619936 Sato MYOD1 H. sapiens TGGGGGCCCCTGCGGCCACCCCG 64137 activate S. pyogenes 25619936 Sato NANOG H...

  26. Cre-lox system

    Type
    Collection
    ...expressed in excitatory neurons aCamKII AAV Yang 107738 pAAV-hSyn-Cre-P2A-dTomato Cre and dTomato hSyn AAV...hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI Cre and tdTomato coexpression Xenopus hsp70 Xenopus...AAV Simpson 72255 pCDH-CB-iCre-P2A-tdTomato-T2A-Puro iCre and tdtomato CB Mammalian Oka 72256 pCDH-CB-copGFP-T2A-iCre...Adenoviral Oka 73351 pAdx-CMV-iCre-P2A-tdTomato iCre and tdTomato CMV Adenoviral Oka 73472 RabV CVS-N2c...Mammalian Sato 122961 pcDNA3.1_PA-Cre-Y324F Catalytically inactive PA-Cre CMV Mammalian Sato 123128 pET-His-Cre...Bacterial Dunlop 135217 pDEST mfap4:icre-p2a-tomato iCre and tdTomato mfap4 Zebrafish Tobin 135618 pAAV-Sox2...Insect Rubin 51503 AAV pCAG-FLEX-tdTomato-WPRE Cre dependent TdTomato expression AAV Zeng 60877 pMAZe ...

  27. Optogenetics AAV Preps

    Type
    Collection
    ...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2...Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR...ChrimsonR tdTomato Cre dependent 1, 5 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen 174007 pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Boyden 105669...plasmids available in Addgene's collection. Opsin Excitatory Wild-type ChR2 ChR2/H134R soCoChR ChR2/other ...

  28. AAV Molecular Tools

    Type
    Collection
    ...from Addgene's viral service encoding tet-off transactivators and tools for affinity purification (TRAP)....Packaging Service: Molecular Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell ...Cell Ablation Tetracycline Transactivators and Inducible Tools These AAV encode tetracycline-inducible tools...tools/controls and tetracycline transactivators that can be used with tetracycline (tet)-inducible expression...CAG-driven, constitutive Expression of the tet-off transactivator (tTA) 2 Gradinaru 99120 pAAV-ihSyn1-tTA Inducible... promoter (ihSyn) Expression of the tet-off transactivator (tTA) with a positive feedback loop for amplified...ihSyn) Cre-dependent expression of the tet-off transactivator (tTA) with a positive feedback loop for amplified...

  29. Ras Pathway

    Type
    Collection
    ... Frederick National Laboratory for Cancer Research . Frederick National Laboratory for Cancer Research...RASA3 RAS p21 protein activator RASAL RASAL1 RASAL2 RASAL3 RAS protein activator like RASGRF RASGRF1 RASGRF2...Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory Subunits PIK3R1 PIK3R2 PIK3R3 PIK3R4 PIK3R5 PIK3R6...Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic and regulatory subunits - Class I PIN1 Peptidylprolyl cis/trans... 1 RALGDS Ral guanine nucleotide dissociation stimulator RAPGEF RAPGEF1 RAPGEF2 Rap guanine nucleotide... RPS6KB2 Ribosomal protein S6 kinase B1 RPTOR Regulatory associated protein of MTOR, complex 1 SAV1 Salvador...

  30. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...100048-AAV1 pAAV.CAG.LSL.tdTomato Hongkui Zeng AV-9-ALL856 100048-AAV9 pAAV.CAG.LSL.tdTomato Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Control Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV.PI.EGFP.WPRE.bGH...Wilson AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Optogenetics Ed Boyden AV-5-PV2527 99039-AAV5 ... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2...
Showing: 1 - 30 of 643 results