Skip to main content
Addgene

We narrowed to 727 results for: cat.1

Showing: 1 - 30 of 727 results
  1. Immunology Research Plasmids and Resources

    Type
    Collection
    ...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7...thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential cation channel, subfamily...TNFSF7 CECR1 cat eye syndrome chromosome region, candidate 1 ADGF, IDGFL CER1 cerberus 1, cysteine knot...variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin lambda variable 3-1 IGLV31, V2-1 IGLV3-10 immunoglobulin lambda...NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif) ligand 14 CC-1, CC-3, CKb1, FLJ16015, HCC-1, HCC... 3 G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 CCL3L1 chemokine (C-C motif) ligand 3-like 1 464.2, D17S1718...
  2. Biosensor AAV Preps

    Type
    Collection
    ...none Constitutive 1 Looger 137955 pAAV.CAG.iAChSnFR CAG iAChSnFR none Constitutive 1, 9 Looger 121922 ...Constitutive 1, 9, rg* GENIE 162379 pGP-AAV-syn-FLEX-jGCaMP8f-WPRE Syn jGCaMP8f none Cre dependent 1, 5, 9, ...dependent 1, 5, 9, rg* GENIE 169258 AAV-hSyn-Soma-jGCaMP8f Syn soma-jGCaMP8f none Constitutive 1, 9, rg*...Constitutive 1, 5, rg* Looger 176753 AAV-mDlx-jGCaMP8f-WPRE Dlx jGCaMP8f none Constitutive 1, 9, rg* Looger...Constitutive 1, 9, rg* Looger 176759 pZac2.1-GfaABC1D-lck-jGCaMP8f GfaABC1D jGCaMP8f none Constitutive 1, 9 Looger...Constitutive 1, 5, 9, rg* GENIE 162377 pGP-AAV-syn-FLEX-jGCaMP8s-WPRE Syn jGCaMP8s none Cre dependent 1, 9, rg...dependent 1, 9, rg* GENIE 167572 AAV-hSyn-Ribo-jGCaMP8s Syn ribo-jGCaMP8s none Constitutive 1 Fyhn 169256...
  3. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...Function PI AV-1-49531P 100040-AAV1 pAAV.hSyn1.Twitch2B.WPRE.SV40 Biosensor Oliver Griesbeck AV-1-50942 50942...Tobias Rose AV-1-PV2723 98929-AAV1 pAAV.hSyn.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-1-PV2724 98931... Looger AV-1-PV2725 98932-AAV1 pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-1-PV2816 100835... Kim AV-1-PV2817 100839-AAV1 pAAV.CAG.Flex.GCaMP6m.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2818 ... Kim AV-1-PV2819 100833-AAV1 pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2820 ... Kim AV-1-PV2821 100845-AAV1 pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2822 ...Douglas Kim AV-1-PV2823 100841-AAV1 pAAV.Syn.GCaMP6m.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2824 100843...
  4. Control AAV Preps

    Type
    Collection
    ...Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB, PHP.S Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, ...Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Roth 50469 pAAV-CaMKIIa-EGFP CaMKIIa EGFP Constitutive 1, 2, 5, 8,...Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Deisseroth 114470 pAAV-Ef1a-mCherry EF1a mCherry Constitutive 1, 2, 5...Constitutive 1, 8 Deisseroth 135630 pAAV-S5E2-dTom-nlsdTom E2 regulatory dTomato Constitutive 1, 9, PHP.eB... dependent 1, 2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, ...dependent 1, 2, 5, 8, 9, rg* Harvey 131002 pAAV-Ef1a-DIO mScarlet EF1a mScarlet Cre dependent 1, 5 Deisseroth...Cre dependent 1, 2, 5, 8, rg* Roth 50459 pAAV-hSyn-DIO-mCherry hSyn mCherry Cre dependent 1, 2, 5, 8, 9,...
  5. Recombinases AAV Preps

    Type
    Collection
    ...Cre.SV40 CamKII none 1, 5, 9, rg* Wilson 105537 pENN.AAV.CMVs.Pl.Cre.rBG CMV none 1, 2, 5, 8, 9, rh10 Wilson...-Cre EF1a none 1, 5, 8, 9, rg* Engel , Nectow 69570 pAAV-EF1a-N-CretrcintG EF1a none 1 Cepko 69571 pAAV-EF1a-C-CreintG...pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn eGFP 1, 2, 5, 8, 9, rg*, PHPeB Wilson 105553 pENN.AAV.hSyn.Cre.WPRE.hGH Syn none 1, 2, 5, 8, 9,...AAV-hSyn-mCherry-P2A-Cre-WPRE Syn mCherry 1 Yang 107738 pAAV-hSyn-Cre-P2A-dTomato Syn dTomato 1, 2, 5, 8, 9, rg*, PHPeB ...mCherry (not a fusion tag) 1, rg* Deisseroth 55637 pAAV-EF1a-Flpo EF1a none 1, 2, rg* Deisseroth 87306 ...pEF1a-DIO-FLPo-WPRE-hGHpA EF1a none 1, 2, 5, 8, 9, rg* Zhang 75469 pAAV-EF1a-Flp-DOG-NW EF1a none 1 Cepko 183412 pAAV-CAG-FlpO... pAAV-EF1a-iCreV EF1a none 1, PHPeB Zeng 140136 pAAV-EF1a-iDreV EF1a none 1, PHPeB Zeng 140137 pAAV-EF1a-iFlpV...
  6. p53 Pathway

    Type
    Collection
    ...-phase expressed 1; also known as GTSE1 BAI-1 Brain-specific angiogenesis inhibitor 1 Bax BCL2-associated...inhibitor type 1), member 1 PERP TP53 apoptosis effector PIDD p53-induced death domain protein 1 PIGs Etoposide... Name 14-3-3-σ Stratifin Apaf-1 Apoptotic peptidase activating factor 1 ATM ATM serine/threonine kinase...kinase 4 or 6 CHK1 Checkpoint kinase 1 CHK2 Checkpoint kinase 2 Cop-1 Ring finger and WD repeat domain 2...receptor superfamily, member 10b E2F-1 E2F transcription factor 1 Fas Fas cell surface death receptor ...SESN1 SESN2 SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin protein ligase 1 TSC2 Tuberous sclerosis 2...Noxa Phorbol-12-myristate-13-acetate-induced protein 1; also known as PMAIP1 p14ARF Cyclin-dependent kinase...
  7. Optogenetics AAV Preps

    Type
    Collection
    ...Constitutive 1, 9 Svoboda 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Fishell...Constitutive 1, 2, 5, 9 Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ChR2/H134R EYFP Constitutive 1, 2, 5...Constitutive 1, 5, rg* Boyden 59171 pAAV-Syn-ChrimsonR-tdT Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden...dependent 1, 5, 9, rg* Deisseroth 26971 pAAV-CaMKIIa-eNpHR 3.0-EYFP CaMKII eNpHR 3.0 EYFP Constitutive 1, 9 ...Constitutive 1, 5, rg* Yizhar 125713 AAV-hSyn1-SIO-eOPN3-mScarlet-WPRE Syn eOPN3 mScarlet Cre dependent 1, 5 Yizhar...Constitutive 1, 5 Yizhar 198511 pAAV_hSyn-DIO-PdCO-mScarlet-WPRE Syn PdCO mScarlet Cre dependent 1, 5 Yizhar...Constitutive 1, 5 Yizhar 198516 pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE EF1a PdCO mScarlet Cre dependent 1, 5 Yizhar...
  8. Ras Pathway

    Type
    Collection
    ...dependent protein kinase 1 PEBP1 Phosphatidylethanolamine binding protein 1 PIK3 Catalytic Subunits PIK3CA PIK3CB...isomerase, NIMA-interacting 1 PLXNB1 Plexin B1 PPP1CA Protein phosphatase 1 catalytic subunit alpha PREX2 Phosphatidylinositol...family member RB1 Retinoblastoma 1 RCE1 Ras converting CAAX endopeptidase 1 RHEB Ras homolog enriched in ...protein of MTOR, complex 1 SAV1 Salvador family WW domain containing protein 1 SCRIB Scribbled planar cell...guanine nucleotide exchange factor 1 YAP1 Yes associated protein 1 Return to top Resources RAS Pathway...Mechanistic target of rapamycin NF1 Neurofibromin 1 NFE2L2 Nuclear factor, erythroid 2 like 2 NFKB1 Nuclear... kappa light polypeptide gene enhancer in B-cells 1 PAK PAK1 PAK2 PAK3 PAK4 p21 protein (Cdc42/Rac)-activated...
  9. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...190293 Anti-AMIGO-1 [L86/14] AMIGO-1 Mouse Mouse IgG2a 190294 Anti-AMIGO-1 [L86/2] AMIGO-1 Mouse Mouse IgG2a...ATPase 1 [L60/4R-2b] Copper ATPase 1 Human Mouse IgG2b 206648 Anti-AMIGO-1 [L86/33R-2b] AMIGO-1 Mouse ...channel [L6/60R-1] Slo1 K+ channel Mouse Mouse IgG1 206695 Anti-AMIGO-1 [L86/33R-1] AMIGO-1 Mouse Mouse IgG2a...Anti-Olig1 [N149/25R-1] Olig1 Mouse Mouse IgG1 206702 Anti-Neurexin-1-Beta [N170A/1R-1] Neurexin-1-Beta Human Mouse...222160 Beclin-1 [N248A/15R] Beclin-1 Mouse Mouse IgG2a 222161 Beclin-1 [N248A/22R] Beclin-1 Mouse Mouse ...Mouse Mouse 190534 Neurexin-1-Beta scFv [N170A/1] N170A/1 scFv Neurexin-1-Beta Human Mouse 190535 PSD-...Mouse 206755 IP3 receptor, type 1 scFv [L24/1] L24/1 scFv IP3 receptor, type 1 Rat Mouse 206756 VSP scFv [...
  10. Chemogenetics AAV Preps

    Type
    Collection
    ...none 1, 9 Roth 83896 pAAV-hDlx-GiDREADD-dTomato-Fishell-5 hM4D(Gi) - Inhibition NLS-dTomato none 1, 9, ...hM3D(Gq) - Activation mCherry fusion Cre-dependent 1, 2, 5, 8, 9, rg*, PHPeB Roth 44362 pAAV-hSyn-DIO-hM4D...hM4D(Gi) - Inhibition mCherry fusion Cre-dependent 1, 2, 5, 8, 9, rg*, PHPeB Roth 65417 pAAV-hSyn-dF-HA-KORD-IRES-mCitrine...mCherry hM3D(Gq) - Activation mCherry fusion none 1, 2, 5, 8, 9, rg* Roth 50475 pAAV-hSyn-hM4D(Gi)-mCherry...mCherry hM4D(Gi) - Inhibition mCherry fusion none 1, 2, 5, 8, 9, rg* Roth 52536 rAAV-CAG::FLEX-rev:: hM4D...hM4D-2a-GFP hM4D(Gi) - Inhibition GFP Cre-dependent 1 Sternson 154867 pAAV-hSyn-fDIO-hM4D(Gi)-mCherry-WPREpA...mCherry hM3D(Gq) - Activation mCherry fusion none 1, 2, 5, 8, 9 Roth 50477 pAAV-CaMKIIa-hM4D(Gi)-mCherry...
  11. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...aeruginosa PA14 234855 (Set 1) 1000000254 Inhibition P. aeruginosa X. Liu NA 1 5,981 (Set 1) 5,971 (Set 2) CHyMErA... Human Doench 3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313...Version 1 1000000069 Knockout Human Moffat 3rd 12 176,500 Toronto KnockOut - Version 3 90294 (1 plasmid...Libraries 153101-153106 Knockout Yeast Borodina N/A 1 Varies Bovine CRISPR Knockout Libraries 213927, 213928...pgRNAs 1,718 Broad GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and...Root 3rd 4 76,441 Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and...and Root 3rd 4 3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and...
  12. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...accumulation in bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based...CEPIA indicators for visualization of Ca(2+) dynamics in mitochondria. Sci Rep. 2020 Feb 18;10(1):2835...pyruvate indicators suitable for biochemical assays and live cell imaging. Sci Rep. 2020 Nov 11;10(1):19562... 2021 Aug 13;11(1):16519. Takeharu Nagai Temperature Fluorescent temperature indicator B-gTEMP Intracellular...photostable chemigenetic indicators for extended in vivo voltage imaging. Science. 2019 Aug 1. pii: science.aav6416...engineer positive-going eFRET voltage indicators. Nat Commun. 2020 Jul 10;11(1):3444. Eric Schreiter Voltage ...
  13. mTOR Pathway

    Type
    Collection
    ...rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1; AKT1 substrate 1 (proline rich) PTEN Phosphatase...PDK1 Pyruvate dehydrogenase kinase, isozyme 1 PI3K Catalytic Subunits PIK3CA PIK3CB PIK3CD PIK3CG Regulatory...translation initiation factor 4E, binding protein 1 Cyclin D1 Also known as CCND1 eIF-4E Eukaryotic translation...RPTOR; Regulatory associated protein of MTOR, complex 1 Rheb Ras homolog enriched in brain S6K Also known ...Mitogen-activated protein kinase associated protein 1 mTOR Mechanistic target of rapamycin p53 TP53; tumor...complex 2 SGK Serum/glucocorticoid regulated kinase 1 Return to top Resources Cancer Pathway ORF Kit (Sabatini...cell and regulates the switch from anabolic to catabolic processes. Active mTORC1 promotes protein and ...
  14. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...oligos 1:10 in ddH 2 O ( e.g., 1.0 μl annealed oligos + 9.0 μl ddH 2 O to yield a concentration of 1 μM)....35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10 min. Optimize PCR ...sgRNAs manually or using freely available online tools 1 . Use these tools to help identify guide sequences...PAM) at the genomic recognition site. NOTE: Figure 1 describes possible deletion strategies for genes and... deletion of Pim1 in mouse ( Mus musculus ; Table 1 , Figure 2A ). NOTE: In this example, sgRNA-A’s protospacer...complement sequences of the Pim1 sgRNA from Table 1 are found in Table 2 . Obtain 24- or 25-mer oligos...SpCas9, but does not contain markers for selection 1 . Other constructs may be utilized, such as pX458 ...
  15. AAV Packaged on Request

    Type
    Collection
    ...Typical Titer Small 10 × 100 µL aliquots 1 mL 4 × 10 12 GC/mL* 1 × 10 13 GC/mL* Medium 25 × 100 µL aliquots...serotype (AAV1, AAV2, AAV5, AAV8, or AAVrg) and volume (1 mL, 2.5 mL, or 5 mL). Currently, we can only package...to 10 weeks. This breaks down as follows: Request 1–2 days Look for the banner on an eligible plasmid ...place your request. We will send you an email within 1-2 days with a response. Most requests will be approved... we can begin processing your order. MTA Approval 1+ business days, varies by requesting organization ...scientist through an MTA. This process typically takes 1–4 days, depending on your institution. AAV Production...implementation letter DNA amplification Viral vector production Density centrifugation purification Addgene’s comprehensive...
  16. AAV Molecular Tools

    Type
    Collection
    ...EYFP 1 Gradinaru Tools for Affinity Purification These AAV encode tools for affinity purification (which...positive feedback loop for amplified tTA expression. 1 Gradinaru 99121 pAAV-ihSyn1-DIO-tTA Cre-dependent ...positive feedback loop for amplified tTA expression. 1 Gradinaru 117383 TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible...synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...synaptophysin-mRuby for labeling of axon terminals. 1 Luo 60658 pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato EF1a-driven...tet-off transactivators and tools for affinity purification (TRAP). Viral... Tools Tetracycline Transactivators Affinity Purification Neurophysiology Cell Ablation Tetracycline Transactivators...
  17. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Brown 11908 pEGFP-N1 alpha-actinin 1 Actin Filaments alpha-actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1...Huttenlocher 11908 pEGFP-N1 alpha-actinin 1 Focal Adhesions alpha-actinin 1 EGFP Carol Otey 31923 pPaxillin-PSmOrange...Autophagosome Sequestosome-1 EGFP Noboru Mizushima 38272 pMXs-IP GFP-WIPI-1 Autophagosome WIPI1 EGFP Noboru...apparatus eNOS(1-33) CFP Alexandra Newton 36205 pmTurquoise2-Golgi Golgi apparatus B4GALT1(1-61) mTurquoise2...Occludens-1 mCherry Michael Davidson 55001 mCherry-Beta-Catenin-20 Adherens Junctions Beta-Catenin mCherry... Shirihai 158003 pCMV-mGold-CAF1-C-10 Nucleus CAF-1 mGold Francois St-Pierre 27705 CAV1-mCherry Caveolae...COXIV-COX8-dL5-2XG4S-mCer3 Mitochondria COX IV-derived (1-22 aa) import sequence and COX VIII signal peptide...
  18. Cre-lox system

    Type
    Collection
    ...Cre-GFP fusion EF-1 alpha Mammalian Sauer 11923 pBS598 EF1alpha-EGFPcre Cre-EGFP fusion EF-1 alpha Mammalian...mCherry coexpression EF-1 alpha AAV Deisseroth 55635 pAAV-EF1a-sCre SCre EF-1 alpha AAV Deisseroth 55636...55636 pAAV-EF1a-Cre Cre EF-1 alpha AAV Deisseroth 55638 pAAV-EF1a-vCre VCre EF-1 alpha AAV Deisseroth 59701...) EF-1 alpha AAV Cepko 69571 pAAV-EF1a-C-CreintG Cre recombinase dependent on GFP (CRE-DOG) EF-1 alpha...rearrangements: inversion, deletion, and translocation. Figure 1. Recombination outcomes are determined ... Mammalian Sauer 11918 pBS513 EF1alpha-cre Cre EF-1 alpha Mammalian Sauer 11919 pBS448 RSV-GFPcre Cre-...11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11956 pBS594 promoterless EGFPcre...
  19. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...AdEasier®-1 cells (strain) - Bacterial strain that contains AdEasy®-1 plasmid...N-terminal Myc tag for mammalian expression pGEX-4T-1-3xMyc - Bacterial vector for Myc tag pETcon(-) - Yeast...PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1 GFP - Retroviral shRNA expression Retroviral backbones...expression under a CMV promoter pAdEasy®-1 - Recombine plasmids from the shuttle... Tet-inducible lentiviral shRNA expression pLKO.1 - TRC cloning vector - Lentiviral shRNA expression...driven puromycin Hygromycin Mammalian, Varies pLKO.1 hygro - Lentiviral shRNA expression lentiCRISPRv2 ...lentiSAMv2 - Lentiviral sgRNA cloning backbone pLKO.1-blast - 3rd gen lentiviral backbone for cloning and...
  20. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ... TATGGTGTCAAACCACAGtgcatgatgactgtctTTCCAGTCTGACCGATGA Dlk1 (site #1) TAL3240 & TAL3241 TGGTGGCGCAGCAGAGGGagctgatccaggaccaGGCCACCGTGAACATCA... TACAAGACAGGGGACAGAagctaaactcatggactgCACAGCTAAGGTAAGA hemogen (site #1) TAL3274 & TAL3275 TGGAAGACCCGTTGGAGAaagagatcccaccaacTGAAATAAAAGATTCAGA...TALEN1297 & TALEN1257 TCTTCCGTTTCCACATCCaccacatcccaacagagcAGCGGGAGCAGCAGTAAA hif1al (site #1) TAL3278 & TAL3279... TAL3338 & TAL3339 TTTCCTCTCATAGTCAATattaattctctatttgGCTCAAAATGTCAGTAAA Plekho1b-1 TAL3142 & TAL3143 TCGTCAAAGCGGGGCCCTcaggatgccaatcaacAGCCTGTGCAGCCCGACA...TAL3366 & TAL3367 TATAGCATGATGATGGAAacggaccttcattcccCGGGACCCCAAACCAACA sox2 (site #1) TAL3178 & TAL3179... TAL3379 TTGCTCCTTGGTTGCATCtctgtcttcattatcaCAAACATTTTCTTCATTA tetmethylcytosinedioxygenase 1 TAL3572 &...TGATCCTCTGGCCCATTAacgactcctgggccaaCTCAAGTAGGGGAAACGA Park2 (site #1) TAL 3012 & TAL 3013 TGGAGCAGGGTGCGAGTGtgtctgagctgaaggaGGCGGTGGGTCGTTTACA...
  21. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin Adherens junctions 107579...Institute ID Tag Protein Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP ...TJP1-mEGFP AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP ...Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi 109122 NPM1-mEGFP AICSDP-50 mEGFP Nucleophosmin...Proliferating cell nuclear antigen (PCNA) DNA replication foci IPSC cell lines can be ordered from the ...the Allen Institute for Cell Science Cell Catalog (Link opens in a new window) . Protocols The Allen Institute...
  22. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...-EF1s 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2-P2A-copGFP 72485 Expresses...pCDH-EF1-DIO-copGFP 72253 Expresses copGFP under EF-1 promoter when Cre is expressed by another vector pCDH-EF1...pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed by another vector pCDH-CB-iCre-P2A-tdTomato-T2A-Puro...vector pCDH-EF1-FLPe 72262 Expresses FLPe from the EF-1 promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express copGFP...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from...copGFP from a truncated EF1 promoter pCDH-EF1S-Nluc 73033 Expresses Nluc from a truncated EF1 promoter ...pCDH-EF1s-copGFP 73034 Expressed copGFP from a truncated EF1 promoter pCDH-CMV-Nluc-P2A-copGFp-T2A-Puro...
  23. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...library as GST-fusion peptides (“mode #1” expression). The mode #1 phosphosite library ( 111704 ) is available...standards for quantitative assessments. The mode #1 phosphosite library can be generated with either phosphoserine...available from Addgene. Screening kinases. The mode #1 phosphosite library can also be synthesized using ...pSerOTS-C1* (V70) Pooled Library 188526 iSPI_pSer_Subpool#1 Pooled Library 188527 iSPI_pSer_Subpool#2 Pooled Library...split mCherry 14-3-3β Pooled Library 111704 Mode #1 Library Pooled Library 111705 Mode #2 Library (14-...partial UAG codon reassignment and release factor 1 deletion. Heinemann IU, Rovner AJ, Aerni HR, Rogulina...the most abundant forms of posttranslational modifications in cells and research into its many roles in...
  24. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Fawzi 127194 RP1B FUS 1-163 QQ4xSS #1 FUS His T7 ALS Nicolas Fawzi 127195 RP1B FUS 1-163 QQ4xSS #2 FUS His... type 1 scFv [L24/1] ITPR1 CMV Spinocerebellar ataxia James Trimmer 206790 IP3 receptor, type 1 scFv [...Cookson 13321 pGEX5X.1 PINK1 WT PINK1 GST tac Parkinson's Mark Cookson 13322 pGEX5X.1 PINK1 KD PINK1 GST... His, V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's... His, V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's...Cookson 29350 pGEX-5X-1-DJ1-WT PARK7 GST tac Parkinson's Mark Cookson 29351 pGEX-5X-1-DJ1-D149A PARK7 GST...Cookson 29352 pGEX-5X-1-DJ1-E64D PARK7 GST tac Parkinson's Mark Cookson 29353 pGEX-5X-1-DJ1-M26I PARK7 GST...
  25. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...endogenous repair mechanisms. Cas3 belongs to the Class 1 family of CRISPR systems, the most abundant type found...bacteria and archaea. While abundant in nature, Class 1 systems are largely underutilized compared to their...still separate the individual Cas components. Figure 1: Overview of Cascade-Cas3 mechanism. Created with ...Insert Promoter PI Publication Bacteria ID Plasmid Gene/Insert Promoter PI Publication Plant ID Plasmid ...RNA Targeting RNA Targeting RNA Editing Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled...Plasmid Gene/Insert Promoter PI Publication Last reviewed on: January 30, 2025 Do you have suggestions for other...
  26. Validated gRNA Sequences

    Type
    Collection
    ...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...Seydoux KANK3 H. sapiens GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT...S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes 25491644 Ward...RAD21 H. sapiens CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall rde-1(D718) C. elegans...elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA... S. pyogenes 25161212 Fire rde-1(H974) C. elegans GATAAATGAGCATAATGAAC 59929 cut S. pyogenes 25161212 ...
  27. Plasmids for Stem Cell Research

    Type
    Collection
    ...reprogramming. Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating EBNA1... with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski Lentivirus Human Expression of human...vector. Proc Natl Acad Sci U S A. 2009 Jan 6. 106(1):157-62. Jaenisch Lentivirus Mouse Doxycycline-inducible...transcription factors. Stem Cell Reports. 2015 Jan 13;4(1):25-36. Broccoli Fibroblasts Sensory Neurons Lentiviral...peripheral sensory neurons. Nat Neurosci. 2015 Jan;18(1):25-35. Baldwin Fibroblasts iTSCs Lentiviral Mouse... from Human ALS Patients. Cell Rep. 2016 Jan 5;14(1):115-28. Zhang Adult Dermal Fibroblasts Neurons Lentiviral... into Neurons. Curr Protoc Cell Biol. 2018 Jun;79(1):e51. Next generation vectors for transcription factor...
  28. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous Type II bacterial...separated by short palindromic repeat sequences. (1) The CRISPR array is transcribed to make the pre-CRISPR...engineering, with Type V following in 2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain...enChIP) using CRISPR. Biochem Biophys Res Commun . 439(1):132-6. PMID: 23942116 Gilbert LA, Horlbeck MA, Adamson...CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol . 35(1):31-34. PMID: 27918548...development of new applications. The first CRISPR papers described two main categories of genome edits. ... lower off-target cleavage frequency. Truncated gRNAs: Truncated gRNAs display less off-target activity...
  29. Lentivirus Plasmids

    Type
    Collection
    ...working with lentivirus: these viruses are based on HIV-1, which may require additional lab biosafety procedures...". ID Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puro resistance...plasmid 24150 for hygro resistance. Weinberg 10878 pLKO.1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid... EGFP coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...included to monitor expression Parijs 11619 pLB 3rd Modification of pLL3.7; Genetic elements known to prevent...
  30. Lentiviral Prep Service

    Type
    Collection
    ...Barcode Library Version 1 Ready-to-use lentiviral particles carrying version 1 of the CellTag barcoding...barcoding library. Version 1 of the Celltag library contains 19973 barcodes to combinatorially index cells for... Accessories for Activating Gene Expression Catalytically-dead Cas9 (dCas9) can be fused to a transactivator...
Showing: 1 - 30 of 727 results