We narrowed to 386 results for: nans
-
TypeBlog Post...fusion between a reporter and a nanobody that’s encoded on a plasmid. A nanobody is a ~150 amino acid, single...protein? No worries! As more nanobodies are developed, there will be more nanobodies to turn into RANbodies....More nanobody expression plasmids can be found here Watch this video to learn more about nanobodies Additional...difficult for individual labs to complete. The nanobody based RANbody platform from the Sanes Lab overcomes...antibodies are produced in animals instead of via recombinant DNA, they can’t be genetically tagged and instead...RANbodies, Yamagata et al used previously published nanobody sequences that targeted the following antigens...and the actin-binding protein gelsolin, but any nanobody sequence could be used to make a RANbody. RANbodies...
-
Technologies Enabled by NanoLuc® Luciferase
TypeBlog Post...moieties in their Nano-Lanterns with NLuc and called their improved creations Enhanced Nano-Lanterns. These... Enhanced Nano-Lanterns to other cellular proteins. BRET-based biosensors utilizing NanoLuc® luciferase...codon-optimized Firefly luciferase genes (e.g., luc2), and NanoLuc® Luciferase are available from the repository. ...Afterall, isn’t science better when we share? NanoLuc® Luciferase-based tools are fantastic examples ... can accelerate your research. The creation of NanoLuc® Luciferase from a rather dull 19kDa Oplophorus...fluorescent proteins to make better biosensors. NanoLuc®-fluorescent protein fusions for imaging Fluorescent...fluor through a process known as bioluminescent resonance energy transfer (BRET). The fluor then emits light... -
Luminescent Imaging with Nano-lanterns
TypeBlog Post... at Osaka University have developed Nano-lantern technology. Nano-lanterns contain a Renilla luciferase...different contexts. Improving Nano-lanterns In 2015, Takai et al. expanded the Nano-lantern color palette to...enhanced Nano-lanterns (eNL) described in Suzuki et al. improve the brightness of previous Nano-lanterns...appropriate for use with Nano-lantern technology. Multicolor imaging using Nano-lanterns requires a linear...separates the signals of various Nano-lanterns, but it does not isolate each Nano-lantern, so Takai et al. used...explained further in Takai et al. Nano-lanterns and ready-made Nano-lantern biosensors are available from...laboratory has assembled a collection of multicolored nano-lanterns for use in various applications, including... -
Plasmids 101: Secondary Nanobody Toolbox
TypeBlog Post...Comparison Advantages of Nanobodies How to Use the Nanobody Toolbox Find Nanobody Plasmids Structural ...anti-mouse and -rabbit IgG secondary nanobodies toolbox. Nanobodies are like tiny antibodies which work...multi-color staining Can be expensive Nanobodies Recombinant; do not require animal sacrifice Good ...Advantages of Nanobodies Although antibodies have been the titans of immunodetection, nanobodies may be better...they can be expressed in bacteria, making nanobodies a recombinant and renewable anti-IgG reagent. Their ... with a tagged nanobody. After this pre-incubation step, the primary antibody-nanobody mix can be added...one-step staining with nanobodies vs two-step staining with antibodies. Nanobodies also simplify multicolor... -
Addgene Begins Distribution of Recombinant Antibodies
TypeBlog Post...antibodies are plasmid-based and recombinant. Learn more about recombinant antibodies here. Finally, Addgene...can participate: If you make recombinant antibodies or other recombinant affinity reagents, share your...the launch of our latest community resource: Recombinant Antibodies! In addition to plasmids and viral...building our antibody resource, which includes recombinant antibodies, educational materials, protocols,... 2016). It’s also been well established that recombinant antibodies are excellent for reproducibility ...and tool users. We encourage you to share your recombinant antibodies via Addgene to maximize the reach ...Additionally, many of the hybridomas from which the recombinant antibodies are derived were tested for specificity... -
Antibodies 101: Producing Recombinant Antibodies
TypeBlog Post...available from several sources, fewer sources of recombinant antibodies (rAbs) exist (though Addgene has a... ready-to-use rAbs and rAb plasmids!). Since recombinant antibodies conveniently allow for unlimited production...experiments. It is possible to produce your own recombinant antibodies with some molecular biology and cell... over the basics of making rAbs. Production Recombinant antibody production can take place in bacterial...produce. The most common yeast strain used for recombinant antibody production is Komagataella phaffii (...Hamster Ovary (CHO) cells. (L'Abbé et al., 2018). Recombinant antibodies can be produced through a single or...Harvest and purification At its core, harvesting recombinant antibodies consists of separating antibodies ... -
Building and Validating Recombinant Antibodies: A Case Study
TypeBlog Post...has also expanded their recombinant affinity reagent tools to include nanobodies. At Addgene, we are excited...Addgene blog: Plasmid-Based Recombinant Antibodies Plasmids 101: Secondary Nanobody Toolbox Antibodies 101...recently announced the launch of an open-access recombinant antibody resource called NABOR (Neuroscience ...The antibodies distributed through NABOR are recombinant antibodies expressed from plasmids that have ...RNA could then be used to generate functional recombinant monoclonal antibody (R-mAb) expression plasmids...preserve and share their own collections. Why Recombinant Antibodies? One of the benefits of using a plasmid...Multiplex immunolabeling with subclass-switched recombinant antibodies in adult rat brain. Figure from Andrews... -
No Llamas Required - Synthetic Nanobodies Against Membrane Proteins
TypeBlog Post...llamas required. The advantages of synthetic nanobodies Nanobodies are small (12-15 kDa) single-domain proteins... antibody, HCab, and nanobody. For more information read our secondary nanobodies blog post. A rapid...Purification RANbodies: Reporter Nanobody Fusions Plasmids 101: Secondary Nanobody Toolbox Resources on Addgene.org...Nanobodies from camelids have gotten a lot of press for being a promising approach for treatment or prophylaxis...prophylaxis of COVID-19. Researchers identified nanobodies that bind to coronavirus spike proteins (Wrapp...using plasmids to generate sybodies, synthetic nanobodies against the spike protein (Walter et al., 2020... that bind to specific antigens. In contrast, nanobodies are a single heavy domain fragment derived from... -
Nanoblades: Tiny CRISPR Ninjas for Genome Editing Difficult Cells
TypeBlog Post...mouse-model generation. Key components of Nanoblades Nanoblades are a Cas9 RNP delivery vehicle that’s based...components of Nanoblades. Image from Mangeot et al., 2019. MLV GAG-POL polyprotein Nanoblades are formed...tropism of Nanoblades, different viral envelope protein(s) are expressed to pseudotype Nanoblades. The team...using Nanoblades? Plasmids are available from Addgene. Genome editing primary cells with Nanoblades Primary...iPSCs and BM cells after Nanoblade treatment as measured by their maintenance of pluripotency marker expression...50% Table 1: Nanoblades editing efficiencies of primary cells. Comparing Nanoblades to Existing CRISPR...in vivo gene editing. The bottom line on Nanoblades Nanoblades are tiny DNA-cutting ninjas which can stealthily... -
Opto-Nanobodies: Using Light to Manipulate Cell Signaling and Protein Purification
TypeBlog Post...ability of its nanobody partner, so it’s important to insert AsLOV2 at a spot in the nanobody that preserves...GFP nanobodies affected binding of their target proteins. The surface-exposed loops of nanobodies seemed...about using nanobodies to control protein activity Read about RANbodies, reporter nanobody fusions Learn...the secondary nanobody toolbox for immunodetection Resources on Addgene.org Find nanobody expression plasmids...proteins, and then elute YFP. Option #2: Opto-Nanobodies (OptoNBs) purification You skip adding a tag ...Toettcher Lab, OptoNBs are photoswitchable engineered nanobodies whose binding of their target protein is altered...have two key components: an AsLOV2 domain and a nanobody. AsLOV2 is a light-oxygen-voltage sensing domain... -
Hot Plasmids June 2018 - Reverse transcriptase, nanobody, and protein-DNA interaction tools
TypeBlog Post...Marcy Patrick Listen to the nanobody toolkit podcast segment Nanobodies are single domain antibody fragments...Zhao C, et al. RNA. 2018 PubMed PMID:29109157. Nanobody toolkit to monitor retrograde transport at the... as regular antibodies. These properties make nanobodies easier to transform and express in bacteria, ... Spiess lab developed a set of functionalized nanobodies to study retrograde transport from the cell surface... a set of plasmids each containing an anti-GFP nanobody fused with a different functional element (tyrosine...different detection methods. Since the anti-GFP nanobody is able to bind fluorescent proteins derived from... from A. victoria the functionalized nanobodies described here can be used to target any protein fused... -
Transfection for Recombinant Antibodies
TypeProtocol...supernatant containing the recombinant antibody can be used as-is or the recombinant antibody can be purified...HEK293 cells to produce recombinant antibody. Protocols... Protocols Transfection for Recombinant Antibodies Transfection...Transfection for Recombinant Antibodies You may also like... Antibody Plasmid Collection Antibodies Blog Posts...Biology Reference General Transfection Protocol Recombinant Antibody Purification Protocol Introduction Transfections...how to transfect suspension HEK293 cells with recombinant antibody plasmids using Polyethylenimine Max ...reagent. After transfection and expression, the recombinant antibody can be purified for use in a variety... -
Hot Plasmids April 2018 - Protein Degradation, Nanoscopy, FIRE-Cas9, and Yeast Expression Tools
TypeBlog Post...PMID: 29153837. Endosomal pH sensors for STED nanoscopy Article contributed by Eric J. Perkins Listen ... -
Addgene Receives NIH BRAIN Initiative Grant to Create Open-Access Recombinant Antibody Resource
TypeBlog Post...plasmid-based recombinant monoclonal antibodies Resources on Addgene.org Find recombinant antibody plasmids... Addgene to create a much needed open-access recombinant antibody/affinity reagent resource for the neuroscience... created thousands of high-quality antibodies/nanobodies for neuroscience research and is an expert at...and data, the platform can be expanded for any recombinant antibody tool and therefore will grow to serve... the entire scientific community. Why recombinant antibodies? Animal-based methods for antibody...cryopreservation (Bradbury & Plückthun, 2015a, b). Recombinant antibodies are plasmid-based and offer numerous...monoclonal antibodies. You can learn more about recombinant antibodies in this blog post. Hello, NABOR! ... -
Plasmid-based Recombinant Monoclonal Antibodies: What They Are and Why You Should Be Excited About Them
TypeBlog Post...Fvasconcellos. How are Recombinant Antibodies Made? To make recombinant antibodies, you first need...chain recombinant monoclonal antibodies as well as other forms of antibody-based (e.g., nanobodies, ScFVs..., 2015). The Many Benefits of Recombinant Antibodies Recombinant antibodies offer numerous advantages...definition of recombinant antibodies are essential for good reproducibility. Non-recombinant antibodies ...MC, Muyldermans S, Leonhardt H (2015) Nanobodies and recombinant binders in cell biology. Journal of Cell...predict a similar revolution for antibodies. Recombinant antibody technology makes it easy for scientists...components of the scientific toolbox. What are Recombinant Antibodies? Antibodies are used by scientists... -
Coomassie Purity Stain of Recombinant Antibodies
TypeProtocol...Coomassie Purity Stain of Recombinant Antibodies Coomassie Purity Stain of Recombinant Antibodies You may also...Posts Antibody Guide Transfection for Recombinant Antibodies Recombinant Antibody Purification Protocol Introduction...13 µL . Prepare the recombinant antibody Dilute or concentrate purified recombinant antibody to a concentration...lane 2 in Figure 1): Sample Peak 1 (contaminant) Peak 2 (contaminant) Peak 3 (HC) Peak 4 (LC) Total Area...protocol to determine purity and concentration of recombinant antibodies using ready-to-use biosafe Coomassie...to determine the purity and concentration of recombinant antibodies using ready-to-use bio-safe Coomassie...how to determine purity and concentration of recombinant antibodies using Coomassie stain. Equipment Heat... -
Affinity Purification of Recombinant Antibodies with Protein A or Protein G
TypeProtocol...Protocols Recombinant Antibody Affinity Purification with Protein A or Protein G Recombinant Antibody ...containing the recombinant antibody to room temperature (see Transfection for Recombinant Antibody protocol...This protocol describes how to affinity purify recombinant antibodies from cell culture supernatant using...Antibody Blog Posts Antibody Guide Transfection for Recombinant Antibodies Immunocytochemistry Protocol Western...instructional video to learn how to affinity purify recombinant antibodies. Workflow Timeline Day 1: Purify antibody...centrifuge compatible with 50 mL conical tubes NanoDrop spectrophotometer 37 °C, 5% CO 2 incubator with... -
Trimmer Lab NeuroMab Collection
TypeCollection...cloned, expressed and validated in recombinant form. The recombinant monoclonal antibodies or R-mAbs have... recombinant monoclonal antibody. Cav1.2 Mouse Mouse IgG2a 225372 SynDIG2 (Mus musculus) recombinant monoclonal...Mouse Mouse Nanobody Plasmid Collection The following plasmids can be used to produce nanobodies from transfected... anti-Homer1 nanobody HS63 Homer1 Mouse Llama 134716 HS69 pComb3xss anti-Homer1 nanobody HS69 Homer1 Mouse... anti-Homer1 nanobody HS89 Homer1 Mouse Llama 134718 HC25 pComb3xss anti-Homer1 nanobody HC25 Homer1 Mouse... anti-Homer1 nanobody HC89 Homer1 Mouse Llama 134720 GC1 pComb3xss anti-Gephyrin nanobody GC1 Gephyrin...anti-Gephyrin nanobody GC83 Gephyrin Mouse Llama 135219 HS22 pEYFPN1 anti-Homer1 nanobody HS22 Homer1 Mouse... -
Luciferase Plasmid Collection
TypeCollection...Bryan Welm 87067 pcDNA3.1-ccdB-Nanoluc NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Taipale 87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning... Taipale 87078 pLenti6.2-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Oskar Laur 87070 pcDNA3.1-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...luciferase Liqun Luo 51970 Nano-lantern/pcDNA3 Nano-lantern CMV Mammalian expression of Nano-lantern Takeharu Nagai...blog . Nano-Lanterns: Fluorescent proteins fused to Renilla luciferase ( Nano-lanterns ) or NanoLuc® ( Enhanced...Enhanced Nano-lanterns and Antares ) for in vivo imaging. NanoBRET : Constructs using NanoLuc® as a BRET... -
Promega Plasmid Collection
TypeCollection...window) and NanoBRET assays (Link opens in a new window) NanoLuc®, HaloTag®, NanoBiT®, and NanoBRET® are Promega... physiological relevance. NanoBiT Assays NanoLuc Binary Technology (NanoBiT) (Link opens in a new window...high-throughput screening in drug discovery. NanoLuc Fusions NanoLuc (Link opens in a new window) is a 19.1 ...interaction, association, and dissociation. NanoBRET Assays NanoBRET (Link opens in a new window) is an energy...molecular proximity in living cells. NanoBRET PPI assays use NanoLuc Luciferase as a BRET energy donor and...competitive displacement of a NanoBRET tracer, reversibly bound to a NanoLuc luciferase-fusion protein expressed...analysis and fusion vectors containing tags such as NanoLuc, HaloTag, SmBiT, and LgBiT, useful for detecting... -
Antibody Plasmid Collection
TypeCollection...Verdoes Backbones for mouse recombinant antibodies A panel of recombinant monoclonal antibodies against..., including monoclonal antibodies, scFvs, and nanobodies. Plasmid... Collection Addgene distributes ready-to-use recombinant antibodies made from plasmids in our collection...alternative approach is to use synthetically produced recombinant antibodies, created by cloning antibody components...Some scientists choose to work with full length recombinant monoclonal antibodies (R-mAbs) expressed in mammalian...research applications from the NeuroMab/Trimmer Lab Recombinant mAb Collection . Once the plasmids are transiently...of production due to their small size. These recombinant antibody fragments can be used in experiments... -
Antibody Guide
TypeCollection...Antibodies produced this way are called recombinant antibodies. Recombinant antibodies are created by cloning... time and labor intensive. Recombinant expression validation A recombinant expression strategy is used...cultured immune cells, or through the use of recombinant plasmids. Animals - Antibodies produced in animals... of a single antibody with little variation. Recombinant plasmids - Antibodies can be produced from plasmids...abundant isotype in blood, also found in tissues; predominant isotype in secondary immune response Monomer ...Single-domain antibodies (sdAbs), also called nanobodies, are ~12-15 kD single heavy domain fragments ...Diabodies can be used for assembling protein nanostructures. Figure 2: An antibody (IgG, far left) compared... -
Deisseroth INTRSECT Collection
TypeCollection...Flp AND Vcre No References Fenno LE, Mattis J, Ramakrishnan C, Hyun M, Lee SY, He M, Tucciarone J, Selimbeyoglu...Hafner G, Witte M, Guy J, Subhashini N, Fenno LE, Ramakrishnan C, Kim YS, Deisseroth K, Callaway EM, Oberhuber...Poulin JF, Caronia G, Hofer C, Cui Q, Helm B, Ramakrishnan C, Chan CS, Dombeck DA, Deisseroth K, Awatramani...Limoges A, Brockway E, Müller K, Fenno L, Kim YS, Ramakrishnan C, Andrási T, Deisseroth K, Holmes A, Hájos ...new window) Yu K, Ahrens S, Zhang X, Schiff H, Ramakrishnan C, Fenno L, Deisseroth K, Zhao F, Luo MH, Gong... M, Johansson Y, Fuzik J, Fürth D, Fenno LE, Ramakrishnan C, Silberberg G, Deisseroth K, Carlén M, Meletis...Burnham N, Cristiano C, Dorrier CE, Tipton GJ, Ramakrishnan C, Kozicz T, Deisseroth K, Thiele TE, McElligott... -
Institute for Protein Innovation
TypeCollection...Find unique recombinant antibodies targeting families of cell surface and secreted proteins from a collaboration...Innovation (IPI) Collection! Here, you’ll find unique recombinant antibodies targeting families of cell surface...courtesy of IPI Browse Glypican Antibodies ID Recombinant Antibody Description Isotype Reactivity Recommended...courtesy of IPI Browse Integrin Antibodies ID Recombinant Antibody Description Isotype Reactivity Recommended...Browse Epitope Tag Antibodies IPI has developed recombinant versions of antibodies that recognize common ... tags and other common cellular proteins. ID Recombinant Antibody Description Isotype Reactivity Recommended... -
Validated gRNA Sequences
TypeCollection...25619936 Sato NANOG H. sapiens TGGCATATTCCTGATTTAAAAGT 64156 activate S. pyogenes 25619936 Sato NANOG H. sapiens...25619936 Sato NANOG H. sapiens TGGGCCTTGGTGAGACTGGTAGA 64154 activate S. pyogenes 25619936 Sato NANOG H. sapiens...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic... -
Antibody Production
TypeCollection...methods and quality control processes for purified recombinant antibodies....webpage for further information. Production For recombinant antibodies (rAb) encoded by mammalian expression...initially titered by spectrophotometry using a NanoDrop spectrophotometer. If needed, the sample is adjusted...performed in parallel with a previous lot of recombinant antibody or the hybridoma-derived equivalent ... Residual Plasmid Sanger Sequencing Purified recombinant antibody preps contain low levels of co-purified... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Temperature Imaging with a Genetically Encoded Nanothermometer. Nano Lett. 2022 Jul 27;22(14):5698-5707. Takeharu...permuted fluorescent protein (cpFP) or fluorescence resonance energy transfer (FRET) efficiency of a pair of...):e35373. Susan Amara , Susan Ingram Citrate Nanosensors for in vivo measurements of citrate (CitA) Engineering...Engineering genetically encoded nanosensors for real-time in vivo measurements of citrate concentrations... levels and metabolism (FLIPmal) Fluorescence Resonance Energy Transfer sensors for quantitative monitoring...Visualize intracellular tryptophan levels and flux Nanosensor detection of an immunoregulatory tryptophan influx...-pHluorin Clathrin-mediated endocytosis is the dominant mechanism of vesicle retrieval at hippocampal ... -
Neurodegeneration Research Collection
TypeCollection...anti-kinesin recombinant scFvs . Niwa et al. Cytoskeleton. 2023 Apr 10. Explore the recombinant monoclonal...familial cases, usually inherited in an autosomal dominant manner, are associated with known genetic mutations...Huntington’s disease (HD) is a fatal autosomal dominant genetic disorder that causes the progressive degeneration..., including monoclonal antibodies, scFvs, and nanobodies. New and Noteworthy: Browse our growing collection... -
COVID-19 Resources
TypeCollection... found on this page: SARS-CoV-2 Antibodies : Recombinant monoclonal antibodies that target SARS-CoV-2 ... Nucleocapsid Protein [mBG17] - Clone mBG17, recombinant mouse monoclonal antibody targeting the SARS-... Nucleocapsid Protein [mBG86] - Clone mBG86, recombinant mouse monoclonal antibody targeting the SARS-...available from Andrea Pauli's lab. Neutralizing nanobodies bind SARS-CoV-2 spike RBD and block interaction...Jul 13. (Link opens in a new window) SARS-CoV-2 Nanobodies now available from Ray Owens' lab. Development... -
Bacterial Expression Systems
TypeCollection... to enhance protein solubility and to direct recombinant proteins to the periplasmic space between the...Timers Return to top Protein Interactions Förster resonance energy transfer (FRET) and bimolecular fluorescence...Escherichia coli , Mycobacterium tuberculosis Vinay Nandicoori 78577 pL99 PnitA-NitR ε-caprolactam Escherichia...Escherichia coli , Mycobacterium tuberculosis Vinay Nandicoori 188974 pREDusk-AmpR-MCS FixK2 Red light (660 ...Addgene Blog Luciferase Technologies Enabled by NanoLuc® Luciferase Fluorescent Biosensors Chromoproteins...