...signaling molecules are horseradish peroxidase (HRP) and fluorophores. Horseradish peroxidase (HRP) HRP ...with several suitable antibodies; if they all meet your criteria, you may either purchase several to compare...epitopes on one antigen. Monoclonal antibodies are generated from cultured B cells, where each culture should...variability. Other Affinity Reagents There are several alternatives to antibodies, ranging from antibody... aliquots of at least 10 µL. Antibodies cannot tolerate freeze-thaw cycles. Here are a few tips for storing...a chemiluminescent reaction in the presence of several different substrates. The luminescence produced...Applications Antibody-based applications can be generally classed into four categories: Quantification -...

...can be generated. The combination of a DNA fragment with a plasmid or vector DNA backbone generates a recombinant...DNA polymerase adding nucleotides. The major difference in this process occurs when the polymerase incorporates...referred to as cloned DNA, and this process of generating multiple identical copies of a recombinant DNA...Site (MCS) Short segment of DNA which contains several restriction enzyme sites, enabling easy insertion...expression will be driven by the promoter. As a general rule, the restriction sites in the MCS are unique...to work with - Plasmids are a convenient size (generally 1,000-20,000 basepairs) for physical isolation...gene. The promoter region is required for the generation of RNA from the insert DNA via transcription....

... vectors that has a DNA topoisomerase I fused to the 3’ end. The topoisomerase acts as a ligase that joins...exonuclease, polymerase and ligase. 5' exonuclease digests the 5' end of dsDNA fragments to generate 3' single-stranded...fragments generating long overhangs that anneal to each other due to their homology. DNA polymerase then closes...years to move around pieces of DNA. Oftentimes several approaches will work for any specific cloning project...research project . The following guide will highlight several of the most popular cloning methods used to create...plasmids used for DNA cloning and expression contain several popular restriction enzyme sites. You can easily...TOPO (Image from Plasmid 101: TOPO Cloning ) Toposiomerase based cloning, often called TOPO® cloning or...

...change in a plasmid (such as point mutations). Generate DNA segments by PCR. Run PCR product on an agarose...anneal to each other. Phusion High-Fidelity DNA Polymerase - incorporates nucleotides to “fill in” the gaps...PCR products, one method is to “stitch” together several oligos. This technique is especially useful for...2009). Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods , 6(5), 343–345...

...of our protocols supports reproducibility and accelerates science. Here, we list the specific equipment...platform. Permeabilize cells for 10 min at room temperature ( RT ) on a rocking platform in 500 µL permeabilization... optimal antibody concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL of the diluted... optimal antibody concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL fluorescently-labeled...

...channels- chimeras C1C2 ChR1-ChR2 chimera 470 ChIEF, ChEF, ChD Engineered by chimeragenesis of ChR1 and...illuminated. There are several different ways to control opsin expression. Generally, the most robust and...-controlled Phytochrome Interacting Factor 6 (PIF6) to PhyB (Phy) interaction 660 Cryptochromes Cryptochrome...and ChR2 450-470 C1V1 ChR1-VChR1 chimera with E122T and E162T mutations 540 Channelrhodopsins: chloride...inhibitory ChR with mutation C128A (derived from C1C2 chimera) 475 GtACR Chloride-conducting channel from Guillardia...neural populations at distinct times. Temporal considerations. Temporal precision is key in optogenetic experiments...activity of a fused protein through allosteric interactions. Researchers continue to engineer new optobiology...

...want to: Generate complete and permanent loss of gene expression or function ( knockout )? Generate a specific... Edit Generate a specific user-defined sequence change in a particular gene, such as generating a point...like never before. This section will provide a general framework to get you started using CRISPR in your...Manipulation Application Cas9 gRNA Additional Considerations Knockout Permanently disrupt gene function ... enrich positive cells, or selection marker to generate stable cell lines (for details, see Plasmids 101...inserted into an AAV transfer vector and used to generate AAV particles (for details, see our AAV Guide ...Cas9 and gRNA In vitro transcription reactions generate mature Cas9 mRNA and gRNA, which are then delivered...

...Use this protocol to generate lentivirus...downstream applications such as stable-cell line generation. Workflow Timeline Day 0: Seed 293T packaging...batch of 1 mg/mL PEI and for each cell line. Considerations Before You Start The health of the packaging...The viral supernatant can be stored at 4 °C for several hours but should be aliquoted and snap frozen in...

...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite...on the type of luciferase used, the luciferin substrate may be the native coelenterazine (CTZ) or chemical...our Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early Chemogenetic...employed type of chemogenetic receptors. There are several different types of DREADDs that can be broadly ...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference...

... under certain conditions. Next-Generation Sequencing Next-generation sequencing allows for parallel sequencing... multiple sequences targeting each gene in the overall library. Barcoding libraries contain plasmids with...to the cells of interest. In either case, next-generation sequencing of the maxiprep DNA is recommended...to the nucleotide analog 6-thioguanine . Next-generation sequencing is the only way to accurately evaluate...outline of how a gRNA library is used. Below are the general steps to take in the screening process. Amplify...selection NEGATIVE screen: Apply library Perform Next Generation Sequencing (NGS) on a control sample (no selection...results between experimental and control cells Generate a list of gRNAs that disappear with addition of...

...annealed can be cloned directly into the overhangs generated by restriction digest of existing sites in the... additional bases to complement the overhangs generated when digesting the vector with EcoRI and SalI ...bench top) allowing for slow cooling to room temperature (~45 minutes). Method #2 Place mixed oligos in...

...downstream applications. Safety Warnings Lentivirus is generally considered biosafety level 2+. Please ensure that... in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health of the target cell...2.5x10 6 TU/mL For a more accurate titer, take the average of multiple dilutions. Sample Data Figure 1: 293T...

...a blunt end ligation. Use T4 DNA Polymerase or Klenow DNA Polymerase I for 3′ overhang removal and 5′ ...gently by pipetting. Incubate tube at appropriate temperature (usually 37 °C) for 1 hour. Always follow the...

... chemical or electrical based transformation, generating what are commonly referred to as 'competent cells... from storage at 4°C and let warm up to room temperature and then (optional) incubate in 37°C incubator...This outgrowth step allows the bacteria time to generate the antibiotic resistance proteins encoded in ...

... there various generations of γ-retrovirus technologies? No, the different “generations” associated with... a structural precursor protein, and Pol is a polymerase. Envelope gene (may be pseudotyped to alter infectivity...γ-retroviral packaging plasmids are not interchangeable. General envelope plasmids, such as VSV-G, however, may ...packaging cell line. For example, Phoenix, a second generation γ-retrovirus packaging cell line developed by...region of the 3’ LTR and are primarily used in gene therapy research to reduce promoter interference and/or...

...AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer... primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...

...using ImageJ software and a standard curve is generated. The ratio of the antibody protein content to ...of our protocols supports reproducibility and accelerates science. Here, we list the specific equipment...relative intensity of the protein bands to the overall lane. Import the gel image into ImageJ. Select ...

...SaCas9) . AAV is also a promising method for gene therapy. Of the commonly used viruses, AAV produces the...thus thought to be the most suitable virus for therapeutic applications. Clinical trials using AAV for various...Publications Viral serotypes and pseudotyping/gene therapy: Designer gene delivery vectors: molecular engineering...virus serotypes: vector toolkit for human gene therapy. Wu Z, Asokan A, Samulski RJ. Mol. Ther. 2006 Sep...adeno-associated virus (AAV) as novel vectors for human gene therapy. Grimm D, Kay MA. Curr Gene Ther. 2003 Aug;3(4)...

...Digest of Plasmid DNA Background Information During several different stages of molecular cloning, it is important...ratio of nucleic acid to protein (260/280) is generally used as an indicator of the purity of DNA samples...

... appropriate temperature. Growth conditions, including copy number and growth temperature, can be found...