Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 1,000 results for: Eras

Showing: 201 - 220 of 1000 results

  1. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...used in gene therapy applications to more specifically direct delivery of gene therapies. Common Uses ...gamma-retroviral vectors. Gene Therapy Gamma-retroviral vectors are a popular choice in gene therapy applications. There...Gamma-retroviral vectors do not have defined “generations” of plasmids, as lentiviral vectors do. For more...line. For example, Phoenix™ is a popular second-generation gamma-retroviral packaging cell line developed...integration into a host’s genome. The process of generating stable cell lines with gamma-retroviral vectors...There are many approved gamma-retroviral gene therapies to treat disease like cancer or immunodeficiency...Delivery of chimeric antigen receptor T cell (CAR-T) therapy is a particularly popular application of gamma-...

  2. Gibson Assembly Protocol

    Type
    Protocol
    ...change in a plasmid (such as point mutations). Generate DNA segments by PCR. Run PCR product on an agarose...anneal to each other. Phusion High-Fidelity DNA Polymerase - incorporates nucleotides to “fill in” the gaps...PCR products, one method is to “stitch” together several oligos. This technique is especially useful for...2009). Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods , 6(5), 343–345...

  3. Immunocytochemistry

    Type
    Protocol
    ...of our protocols supports reproducibility and accelerates science. Here, we list the specific equipment...platform. Permeabilize cells for 10 min at room temperature ( RT ) on a rocking platform in 500 µL permeabilization... optimal antibody concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL of the diluted... optimal antibody concentration will vary but generally ranges from 1-10 µg/mL. Add 500 µL fluorescently-labeled...

  4. Optogenetics Guide

    Type
    Guide
    ...channels- chimeras C1C2 ChR1-ChR2 chimera 470 ChIEF, ChEF, ChD Engineered by chimeragenesis of ChR1 and...illuminated. There are several different ways to control opsin expression. Generally, the most robust and...-controlled Phytochrome Interacting Factor 6 (PIF6) to PhyB (Phy) interaction 660 Cryptochromes Cryptochrome...and ChR2 450-470 C1V1 ChR1-VChR1 chimera with E122T and E162T mutations 540 Channelrhodopsins: chloride...inhibitory ChR with mutation C128A (derived from C1C2 chimera) 475 GtACR Chloride-conducting channel from Guillardia...neural populations at distinct times. Temporal considerations. Temporal precision is key in optogenetic experiments...activity of a fused protein through allosteric interactions. Researchers continue to engineer new optobiology...

  5. Plan Your Experiment

    Type
    Guide
    ...want to: Generate complete and permanent loss of gene expression or function ( knockout )? Generate a specific... Edit Generate a specific user-defined sequence change in a particular gene, such as generating a point...like never before. This section will provide a general framework to get you started using CRISPR in your...Manipulation Application Cas9 gRNA Additional Considerations Knockout Permanently disrupt gene function ... enrich positive cells, or selection marker to generate stable cell lines (for details, see Plasmids 101...inserted into an AAV transfer vector and used to generate AAV particles (for details, see our AAV Guide ...Cas9 and gRNA In vitro transcription reactions generate mature Cas9 mRNA and gRNA, which are then delivered...

  6. Chemogenetics Guide

    Type
    Guide
    ...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite...on the type of luciferase used, the luciferin substrate may be the native coelenterazine (CTZ) or chemical...our Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early Chemogenetic...employed type of chemogenetic receptors. There are several different types of DREADDs that can be broadly ...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference...

  7. Lentivirus Production

    Type
    Protocol
    ...Use this protocol to generate lentivirus...downstream applications such as stable-cell line generation. Workflow Timeline Day 0: Seed 293T packaging...batch of 1 mg/mL PEI and for each cell line. Considerations Before You Start The health of the packaging...The viral supernatant can be stored at 4 °C for several hours but should be aliquoted and snap frozen in...

  8. Guide to Using Pooled Libraries

    Type
    Guide
    ... under certain conditions. Next-Generation Sequencing Next-generation sequencing allows for parallel sequencing... multiple sequences targeting each gene in the overall library. Barcoding libraries contain plasmids with...to the cells of interest. In either case, next-generation sequencing of the maxiprep DNA is recommended...to the nucleotide analog 6-thioguanine . Next-generation sequencing is the only way to accurately evaluate...outline of how a gRNA library is used. Below are the general steps to take in the screening process. Amplify...selection NEGATIVE screen: Apply library Perform Next Generation Sequencing (NGS) on a control sample (no selection...results between experimental and control cells Generate a list of gRNAs that disappear with addition of...

  9. Plasmid Modification by Annealed Oligo Cloning (with Protocols)

    Type
    Protocol
    ...annealed can be cloned directly into the overhangs generated by restriction digest of existing sites in the... additional bases to complement the overhangs generated when digesting the vector with EcoRI and SalI ...bench top) allowing for slow cooling to room temperature (~45 minutes). Method #2 Place mixed oligos in...

  10. Fluorescence Titering Assay

    Type
    Protocol
    ...downstream applications. Safety Warnings Lentivirus is generally considered biosafety level 2+. Please ensure that... in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health of the target cell...2.5x10 6 TU/mL For a more accurate titer, take the average of multiple dilutions. Sample Data Figure 1: 293T...

  12. Protocol - Bacterial Transformation

    Type
    Protocol
    ... chemical or electrical based transformation, generating what are commonly referred to as 'competent cells... from storage at 4°C and let warm up to room temperature and then (optional) incubate in 37°C incubator...This outgrowth step allows the bacteria time to generate the antibiotic resistance proteins encoded in ...

  13. Sequencing Primers

    Type
    Guide
    ...AGTCAAGTAACAACCGCGA 3' end of luciferase, forward primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer... primer LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer pGP704-R AACAAGCCAGGGATGTAACG...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase, forward primer RVprimer3 CTAGCAAAATAGGCTGTCCC...

  14. Coomassie Purity Stain of Recombinant Antibodies

    Type
    Protocol
    ...using ImageJ software and a standard curve is generated. The ratio of the antibody protein content to ...of our protocols supports reproducibility and accelerates science. Here, we list the specific equipment...relative intensity of the protein bands to the overall lane. Import the gel image into ImageJ. Select ...

  15. DNA Quantification

    Type
    Protocol
    ...Digest of Plasmid DNA Background Information During several different stages of molecular cloning, it is important...ratio of nucleic acid to protein (260/280) is generally used as an indicator of the purity of DNA samples...

  17. Colony Formation Titering Assay

    Type
    Protocol
    ... in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health of the target cell...,000 TU/mL For a more accurate titer, take the average of multiple dilutions. Sample Data Figure 1: A549...

  18. Using a Light Microscope Protocol

    Type
    Protocol
    ...look at the side of an objective, you will see several pieces of information, but the most important (...your observations. Some microscopes have digital cameras attached to them that allow you to capture images...

  19. Protocol - How to Run an Agarose Gel

    Type
    Protocol
    ...gel at 4 °C for 10-15 mins OR let sit at room temperature for 20-30 mins, until it has completely solidified... gel, make 10% more volume than needed because several microliters can be lost in pipetting. For example...
Showing: 201 - 220 of 1000 results