We narrowed to 1,002 results for: Eras

...plant expression vectors containing several cassettes and generate multi-construct transgenic plants. ...designed with flexibility to allow for additional iterations of assembly. Combining multiple Level 2 vectors...Johannes Stuttmann 95 additional plasmids for hierarchical assembly of plant multigene constructs. MoClo...complementation experiments to analyze protein-protein interactions in plants. MoClo-YTK Yeast Expression John Dueber...characterized parts that can be used for bottom-up hierarchical assembly of single and multi-gene constructs...Yeast Expression Sylvestre Marillonnet Plasmids to generate transcription units for protein secretion in yeasts...Yeast Expression Elena Caro Bernat Plasmids for generating transcriptional units using the GoldenBraid system...

...light-emitting luciferase and a light-sensing optogenetic element. When the luciferase substrate (luciferin...luciferin) is added, the luciferase enzyme generates light that activates the opsin. The opsin may excite...on the type of luciferase used, the luciferin substrate may be the native coelenterazine (CTZ) or chemical...Addgene's Chemogenetics Plasmid Collection . Figure 1: General overview of a chemogenetics experiment. Early Chemogenetic...employed type of chemogenetic receptors. There are several different types of DREADDs that can be broadly ...Coupling brighter bioluminescent modules, such as luciferase-fluorescent protein fusions, to more-sensitive...Descriptions of LMOs and their activity in neurons LMO Luciferase Opsin Ligand Effect Outcome (in neurons) Reference...

... under certain conditions. Next-Generation Sequencing Next-generation sequencing allows for parallel sequencing... multiple sequences targeting each gene in the overall library. Barcoding libraries contain plasmids with...to the cells of interest. In either case, next-generation sequencing of the maxiprep DNA is recommended...for lentiviral of DNA-based screens. NGS = next-generation sequencing. Created with BioRender.com. Types...to the nucleotide analog 6-thioguanine . Next-generation sequencing is the only way to accurately evaluate...selection NEGATIVE screen: Apply library Perform Next Generation Sequencing (NGS) on a control sample (no selection...results between experimental and control cells Generate a list of gRNAs that disappear with addition of...

...Digest of Plasmid DNA Background Information During several different stages of molecular cloning, it is important...ratio of nucleic acid to protein (260/280) is generally used as an indicator of the purity of DNA samples...

... appropriate temperature. Growth conditions, including copy number and growth temperature, can be found...

... in the lab by heating to 56 °C for 30 min. Considerations Before You Start The health of the target cell...,000 TU/mL For a more accurate titer, take the average of multiple dilutions. Sample Data Figure 1: A549...

...look at the side of an objective, you will see several pieces of information, but the most important (...your observations. Some microscopes have digital cameras attached to them that allow you to capture images...

...gel at 4 °C for 10-15 mins OR let sit at room temperature for 20-30 mins, until it has completely solidified... gel, make 10% more volume than needed because several microliters can be lost in pipetting. For example...

...AGTCAAGTAACAACCGCGA 3' end of luciferase Forward LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase Reverse M13 Forward...Sequencing Primers Though Addgene mainly uses next-generation sequencing (NGS) for plasmid verification, Addgene...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward pGP704-R AACAAGCCAGGGATGTAACG R6K gamma...Rluc-F CCAGGATTCTTTTCCAATGC 3' end of Renilla luciferase Forward RVprimer3 CTAGCAAAATAGGCTGTCCC 5' of ...

... gel, make 10% more volume than needed because several microliters can be lost in pipetting. For example...

...Handling Plasmids Genomic Deletions with CRISPR Generate genomic deletions in mammalian cells lines using...

...organisms such as Staphylococcus aureus or Vibrio cholerae . BSL-2 includes all of the precautions needed...

...Existing therapies and effects on immune system Conventional cancer therapies include radiation therapy (owing... Types of immunotherapeutics In lieu of the cancer-immune system interactions, therapeutics have been ...Curie), chemotherapy, and surgical removal of the tumor. However, these conventional therapies produce...cell-surface tolerance-producing proteins are one of the most commonly used immunotherapeutic agents. Currently...contestants for cell-based immunotherapy. Using activated DCs ex vivo to generate cytotoxic effector T cells...beneficiaries. Collaborative therapy For the most efficient outcomes, collaborative therapies must be explored. ... multiple immunotherapy targets can be utilized at the same time. A combination of tolerance marker blockade...

...combination of the promoter (RNA polymerase binding site) and operators (response elements). Promoters ...      The RNA polymerase(s) RNA is transcribed from DNA using an RNA polymerase (RNAP). In bacteria...     Description Expression Additional considerations CMV General expression mRNA Strong mammalian expression...PGK1 (human or mouse) General expression mRNA Mammalian promoter from phosphoglycerate kinase gene.  Constitutive...promoter with low basal activity and several tetracycline operators. Transcription can be turned on or ...promoter. GDS General expression mRNA  Strong yeast expression promoter from glyceraldehyde 3-phosphage ...Description Expression Additional considerations T7 in vitro transcription/ general expression Promoter from ...

...under the control of the cI857 temperature-sensitive repressor. The temperature-controlled expression of the...allows genome editing and mutant library generation in several biotechnologically and clinically relevant...proteins. Overall BioID2 improves the efficiency of screening for protein–protein interactions. The Roux...on protein-protein interactions and therefore identifying and studying interaction networks is important...Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly luciferase. The bait and prey...A tag. The luciferase activities can then be measured and normalized to assess interactions. Higher relative...firefly luciferase activity in the Co-IP compared of a control Co-IP indicates stronger interaction. The ...

...Current CRISPR Therapies Cancer and CAR-T therapy The FDA has already approved CAR-T immunotherapy for cancer...delivery and editing strategies for CRISPR therapies. Systemic therapies involve CRISPR-Cas delivery directly...next few months. Several other companies have followed suite, with Beam Therapeutics initiating a base... initiated a CRISPR therapy for hATTR with the first-ever systemic CRISPR therapy. They engineered a CRISPR-Cas...this therapy is affecting hATTR patient outcomes. Bacterial infection and HIV Most CRISPR therapies have...part of a cocktail therapy for urinary tract infections. The Cas3 enzymes target several strains of E. coli...sponsored by Excision Biotherapeutics. Additional ongoing trials The CRISPR therapies don’t stop with the...

...spatial and hierarchical chromatin interaction networks. Think of these chromatin interactions networks ...pictures” generated with current 3C methods provide useful information about chromatin interactions, they ...could detect multiple chromatin interactions at once. Chromatin interactions at five sites in the well-characterized...chromatin interactions identified with the multiplexed CAPTURE 2.0 largely replicated interactions previously...Determining the spatial and hierarchical organization of chromatin interaction networks  A second application...enhancers are interacting with which promoters, what part of a gene enhancers like to interact with, and ...that forms chromosomes. These long range DNA interactions are often detected with chromosome conformation...

... that the ligation regenerates the original restriction sites for further iterative cloning steps and ...and voltage sensitivity. This hierarchical screen led to the generation of two enhanced voltage indicators...Instead, coelenterazine is supplied to the culture media as a chemical substrate for Renilla luciferase. This...alternative to the widely used luciferase reporter gene plasmid pGL3 pGL3 luciferase reporter gene plasmids... issues with fluorescent pH sensors, a set of luciferase-fluorophore pH fusion reporters, pRSETb-pHlash...insensitivity to other ions In BRET, A mutant Renilla luciferase, catalyzes the oxidation of its substrate, luciferin...control of signalling pathways. These LIDs are generalizable, versatile and powerful tools which allow you...

...Second-generation vectors are likely sufficient for most experiments; however, the 3rd-generation packaging... 2nd vs. 3rd Generation Lentiviral Plasmids Q3: How can you tell 2nd- and 3rd-generation transfer vectors...considered safer. Second-generation transfer plasmids MUST be packaged with a 2nd-generation system because the... Third-generation plasmids can be packaged with either system. Please note that the generation used to...limiting the interaction between viral LTR enhancers and the transgene; such interactions can alter expression...production (3 or 4). Third-generation vectors contain gag, pol, and rev. Second-generation contains those three...and the plasmid coding for an envelope. Three generations of lentiviral packaging systems have been developed...

...protein-protein interactions, RNA-protein interactions, and even more recently cell-cell interactions. If you’... binary protein-protein interaction as well as identify additional interacting proteins in one simple ...RNA-protein interaction detection So far, we’ve covered ways to study protein-protein interactions, but scientists...RNA-protein interactions that can regulate multiple biological functions. RapID (RNA-protein interaction detection... mammalian cells (Milo, 2013). The number of interactions between these proteins is hard to imagine yet...yet alone study. To elucidate these interactions scientists have long used antibody based affinity purification...proximity-based labeling to better capture these interactions in a vast array of biological contexts.  Proximity...