Skip to main content
Addgene

We narrowed to 814 results for: MAL

Showing: 41 - 60 of 814 results
  1. Immunology Research Plasmids and Resources

    Type
    Collection
    ...DHLAG, HLADG, Ia-GAMMA CD8A CD8a molecule CD8, Leu2, MAL, p32 CD8B CD8b molecule CD8B1, LYT3, Leu2, Ly3, MGC119115...cytotoxicity triggering receptor 3 1C7, CD337, LY117, MALS, NKp30 NFAT5 nuclear factor of activated T-cells...TRAP, gp39, hCD40L CD8A CD8a molecule CD8, Leu2, MAL, p32 CD8B CD8b molecule CD8B1, LYT3, Leu2, Ly3, MGC119115... HSCR, HSCR2 EGF epidermal growth factor (beta-urogastrone) HOMG4, URG EGFR epidermal growth factor receptor...Categories Plasmid Tables Additional Resources Mammalian organisms are exposed to millions of potential...Chemokines Chemokines, or chemotactic cytokines, are small proteins that can be secreted by immune cells and...X-associated protein - SHFM1 split hand/foot malformation (ectrodactyly) type 1 DSS1, ECD, SEM1, SHFD1...
  2. Ras Pathway

    Type
    Collection
    ...RPS6KA2 RPS6KA3 RPS6KA6 Ribosomal protein S6 kinase RPS6KB RPS6KB1 RPS6KB2 Ribosomal protein S6 kinase B1...collection of plasmids for the Ras pathway. Ras is a small GTPase and constitutively active Ras is the most...Plasmids Ras Gene List Resources Background Ras is a small GTPase and is a member of the G protein (guanine...addition and removal of a phosphate group. Under normal physiological conditions GTPases play prominent...factor ECT2 Epithelial cell transforming 2 EGFR Epidermal growth factor receptor EIF4EBP EIF4EBP1 EIF4EBP2...Ras-related C3 botulinum toxin substrate (rho family, small GTP binding protein Rac) RAF AFAF BRAF RAF1 Serine...
  3. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...localization. ACP and MCP tags ACP- and MCP-tags are small protein tags based on the acyl carrier protein. ...SNAP-tag Empty backbone for stable and transient mammalian expression 101133 pSNAP-CaaX Control Plasmid SNAP-tag...CLIP-tag Empty backbone for stable and transient mammalian expression 101134 pCLIPf-H2B Control Plasmid CLIP-tag...Vector ACP/MCP-tag Empty backbone for transient mammalian expression 101126 pACP-tag (m)- 2 Vector ACP/MCP-tag...MCP-tag Empty backbone for stable and transient mammalian expression 101132 pMCP-GPI Control Plasmid ACP... Marahiel MA.1998. Peptide bond formation in nonribosomal peptide biosynthesis. Catalytic role of the ...
  4. Bacterial Expression Systems

    Type
    Collection
    ...bind to a small molecule, the reporter plasmid can be used to detect the presence of that small molecule...Signal peptides for periplasmic localization: PelB, MalE, OmpA ID Plasmid Promoter Tags PI Additional Addgene...visualization inside living or fixed bacterial and mammalian cells. Addgene Blog A Guide to Selecting Fluorescent... Fluorescent Protein Guide for a selection of mammalian and bacterial FRET-related vectors and standards...expression levels can be controlled by a variety of small molecules, light, and temperature, in different ...control the expression of up to twelve genes using small-molecule inducers in the same E. coli strain. Addgene...
  5. CRISPR References and Information

    Type
    Collection
    ...Includes a wide range of reference genomes, including animals, plants, bacteria, fungi, protists, and viruses...Link opens in a new window) Program for designing optimal gRNAs. Provides feedback on number of potential...human. Developed by the George Church Lab . CRISPR Optimal Target Finder (Link opens in a new window) Identification...cloning pCRISPR PDF, 109 KB Mendenhall and Myers Mammalian: FLAG tagging endogenous proteins pFETCh_Donor...Orkin and Bauer Protocol for Genomic Deletions in Mammalian Cell Lines pSpCas9(BB) (pX330) Protocol at Addgene...
  6. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ... that function in mammalian cells can be used to attentuate RNA levels. In mammalian systems, Cas13a does...available for expression in mammalian systems, bacteria, and plants. Mammalian ID Plasmid Gene/Insert Promoter...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...
  7. Caltech Systemic Capsids

    Type
    Collection
    ...GRE or transgenic animal Oligodendrocytes - AAV-PHP.eB with GRE or transgenic animal Brain vascular cells...GRE or transgenic animal L5 & Inhibitory - AAV-PHP.eB with GRE or transgenic animal L2/3 & L4 - AAV.CAP-B10...with GRE or transgenic animal Excitatory - AAV.PHP.N with GRE or transgenic animal For PNS applications ...
  8. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...for expression in mammalian systems, bacteria, plants, yeast, and zebrafish. Mammalian ID Plasmid Gene/...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...and they can convert cytidine to uridine within a small editing window near the PAM site. Uridine is subsequently...editors are designed to work in a very narrow window proximal to the PAM sequence, some base editing systems...
  9. Promega Plasmid Collection

    Type
    Collection
    ...including E. coli , mammalian cells, and cell-free systems. HiBiT Fusions HiBiT is a small, multifunctional...BiT (LgBiT; 18 kDa) subunit and a small complementary peptide, Small BiT (SmBiT; 11 amino acids). This... and extracellular applications where you want minimal disruption of endogenous protein expression and...
  10. Brain Initiative Collection

    Type
    Collection
    ...fluorophore and targeted to the neuronal soma and proximal dendrites in a viral vector Hillel Adesnik 107708...channelrhodopsin ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by...export signal and targeted to the neuronal soma and proximal dendrites under the control of internal ribosome...genetically encoded dopamine sensor RdLight1 in mammalian cells. Lin Tian 125708-AAV9 pAAV-hSynapsin1-RdLight1...genetically encoded dopamine sensor RdLight1 in mammalian neurons. Lin Tian 127090-PHPeB pAAV-CAG-DIO-ChR2... in AAV production vector expressed under the mammalian promoter (EF1a) Francois St-Pierre 179460-AAV1...AAV production vector under the control of the mammalian promoter (EF1a) Francois St-Pierre 179463-AAV9...
  11. CRISPR Plasmids - RNA Editing

    Type
    Collection
    ...for CRISPR plasmids for RNA editing in mammalian systems. Mammalian ID Plasmid Gene/Insert PI Publication...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...truncation retain RNA editing capabilities but are small enough to be packaged in AAV particles. Want more...
  12. CRISPR Plasmids - CRISPR Transposases (CAST)

    Type
    Collection
    ...are available for expression in mammalian systems and bacteria. Mammalian ID Plasmid Gene/Insert Promoter...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish... used in bacteria genome editing, though some mammalian systems have been developed. Figure 1: Overview...
  13. Zhang Lab CRISPR Page

    Type
    Collection
    ...nuclease system to facilitate genome editing in mammalian cells (Cong et al ., Science 2013, Ran et al ....Plasmids The CRISPR/Cas system can be implemented in mammalian cells by co-expressing the S. pyogenes Cas9 (SpCas9... are two sets of 3 vectors each available for mammalian endogenous gene activation using SAM: Addgene ...adeno-associated virus (AAV). The single vector system uses a smaller Cas9 from S. aureus (SaCas9) that has been human...In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Swiech L, Heidenreich...
  14. Validated gRNA Sequences

    Type
    Collection
    ...CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; gRNA2: ...GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; gRNA2: ...GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2:AGGTTTCTAAAACATGACGG...AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2:TCAACCGTCCCTGCAAGGCT...TCAACCGTCCCTGCAAGGCT 72623 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAAACCTCGTGTAGCTATCA; gRNA2: ...
  15. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...Human Bradley 3rd ~9 pairs/exon 9,508 Mouse CRISPR Proximal Poly(A) Site Knockout Library 190744 Knockout ... 6 Varies Enriched subpools (kinase, nuclear, ribosomal, cell cycle) 51043 — 51048 Knockout Human Sabatini...Pan-Druggable Cancer Library 182133 Knockout Human Mali 3rd 1 74 Perturb-seq Guide Barcodes (GBC) 85968 ...
  16. CRISPR Plasmids - dCas9-FokI

    Type
    Collection
    ... available for expression in mammalian systems and Drosophila. Mammalian ID Plasmid Gene/Insert Promoter...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...
  17. Plasmids for Stem Cell Research

    Type
    Collection
    ...tracking of reprogramming factors Fluorescent tagged episomals for stoichiometric induced pluripotent stem cell...Fibroblasts Cholinergic Neurons Lentiviral Human Small molecules enable neurogenin 2 to efficiently convert... Cell Rep. 2016 Jan 5;14(1):115-28. Zhang Adult Dermal Fibroblasts Neurons Lentiviral Human REST suppression...
  18. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ... for epigenetic modification in mammalian or plant systems. Mammalian ID Plasmid Gene/Insert Promoter ...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...
  19. CRISPR Plasmids - Repress Gene Expression

    Type
    Collection
    ...available for expression in mammalian systems, bacteria, plants, and yeast. Mammalian ID Plasmid Gene/Insert...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...
  20. CRISPR Plasmids - Activate Gene Expression

    Type
    Collection
    ...for expression in mammalian systems, bacteria, Drosophila, plants, and yeast. Mammalian ID Plasmid Gene/...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...
Showing: 41 - 60 of 814 results