Skip to main content
Addgene
Open Menu

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 817 results for: MAL

Showing: 41 - 60 of 817 results

  1. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...localization. ACP and MCP tags ACP- and MCP-tags are small protein tags based on the acyl carrier protein. ...SNAP-tag Empty backbone for stable and transient mammalian expression 101133 pSNAP-CaaX Control Plasmid SNAP-tag...CLIP-tag Empty backbone for stable and transient mammalian expression 101134 pCLIPf-H2B Control Plasmid CLIP-tag...Vector ACP/MCP-tag Empty backbone for transient mammalian expression 101126 pACP-tag (m)- 2 Vector ACP/MCP-tag...MCP-tag Empty backbone for stable and transient mammalian expression 101132 pMCP-GPI Control Plasmid ACP... Marahiel MA.1998. Peptide bond formation in nonribosomal peptide biosynthesis. Catalytic role of the ...

  2. Bacterial Expression Systems

    Type
    Collection
    ...bind to a small molecule, the reporter plasmid can be used to detect the presence of that small molecule...Signal peptides for periplasmic localization: PelB, MalE, OmpA ID Plasmid Promoter Tags PI Additional Addgene...visualization inside living or fixed bacterial and mammalian cells. Addgene Blog A Guide to Selecting Fluorescent... Fluorescent Protein Guide for a selection of mammalian and bacterial FRET-related vectors and standards...expression levels can be controlled by a variety of small molecules, light, and temperature, in different ...control the expression of up to twelve genes using small-molecule inducers in the same E. coli strain. Addgene...

  3. CRISPR References and Information

    Type
    Collection
    ...Includes a wide range of reference genomes, including animals, plants, bacteria, fungi, protists, and viruses...Link opens in a new window) Program for designing optimal gRNAs. Provides feedback on number of potential...human. Developed by the George Church Lab . CRISPR Optimal Target Finder (Link opens in a new window) Identification...cloning pCRISPR PDF, 109 KB Mendenhall and Myers Mammalian: FLAG tagging endogenous proteins pFETCh_Donor...Orkin and Bauer Protocol for Genomic Deletions in Mammalian Cell Lines pSpCas9(BB) (pX330) PDF, 330 KB Parrott...

  4. CRISPR Plasmids - RNA Targeting

    Type
    Collection
    ... that function in mammalian cells can be used to attentuate RNA levels. In mammalian systems, Cas13a does...available for expression in mammalian systems, bacteria, and plants. Mammalian ID Plasmid Gene/Insert Promoter...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...

  5. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...for expression in mammalian systems, bacteria, plants, yeast, and zebrafish. Mammalian ID Plasmid Gene/...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...and they can convert cytidine to uridine within a small editing window near the PAM site. Uridine is subsequently...editors are designed to work in a very narrow window proximal to the PAM sequence, some base editing systems...

  6. Caltech Systemic Capsids

    Type
    Collection
    ...GRE or transgenic animal Oligodendrocytes - AAV-PHP.eB with GRE or transgenic animal Brain vascular cells...GRE or transgenic animal L5 & Inhibitory - AAV-PHP.eB with GRE or transgenic animal L2/3 & L4 - AAV.CAP-B10...with GRE or transgenic animal Excitatory - AAV.PHP.N with GRE or transgenic animal For PNS applications ...

  7. Brain Initiative Collection

    Type
    Collection
    ...fluorophore and targeted to the neuronal soma and proximal dendrites in a viral vector Hillel Adesnik 107708...channelrhodopsin ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by...export signal and targeted to the neuronal soma and proximal dendrites under the control of internal ribosome...genetically encoded dopamine sensor RdLight1 in mammalian cells. Lin Tian 125708-AAV9 pAAV-hSynapsin1-RdLight1...genetically encoded dopamine sensor RdLight1 in mammalian neurons. Lin Tian 127090-PHPeB pAAV-CAG-DIO-ChR2... in AAV production vector expressed under the mammalian promoter (EF1a) Francois St-Pierre 179460-AAV1...AAV production vector under the control of the mammalian promoter (EF1a) Francois St-Pierre 179463-AAV9...

  8. Promega Plasmid Collection

    Type
    Collection
    ...including E. coli , mammalian cells, and cell-free systems. HiBiT Fusions HiBiT is a small, multifunctional...BiT (LgBiT; 18 kDa) subunit and a small complementary peptide, Small BiT (SmBiT; 11 amino acids). This... and extracellular applications where you want minimal disruption of endogenous protein expression and...

  9. CRISPR Plasmids - RNA Editing

    Type
    Collection
    ...for CRISPR plasmids for RNA editing in mammalian systems. Mammalian ID Plasmid Gene/Insert PI Publication...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...truncation retain RNA editing capabilities but are small enough to be packaged in AAV particles. Want more...

  10. CRISPR Plasmids - CRISPR Transposases (CAST)

    Type
    Collection
    ...are available for expression in mammalian systems and bacteria. Mammalian ID Plasmid Gene/Insert Promoter...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish... used in bacteria genome editing, though some mammalian systems have been developed. Figure 1: Overview...

  11. Zhang Lab CRISPR Page

    Type
    Collection
    ...nuclease system to facilitate genome editing in mammalian cells (Cong et al ., Science 2013, Ran et al ....Plasmids The CRISPR/Cas system can be implemented in mammalian cells by co-expressing the S. pyogenes Cas9 (SpCas9... are two sets of 3 vectors each available for mammalian endogenous gene activation using SAM: Addgene ...adeno-associated virus (AAV). The single vector system uses a smaller Cas9 from S. aureus (SaCas9) that has been human...In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Swiech L, Heidenreich...

  12. Validated gRNA Sequences

    Type
    Collection
    ...CAGAACACCCCCATCGGCGA 72619 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAACCGGTGGGGCTGCGTCA; gRNA2: ...GGCAGGAGAGGCCAGTTGCG 72620 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GCAACTTCCATTTTCAGTCT; gRNA2: ...GGAAGCCTCAGCTCGCCTGA 72621 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GCTGGGGCTCAGTTGCGTAA; gRNA2:AGGTTTCTAAAACATGACGG...AGGTTTCTAAAACATGACGG 72622 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1:GTTGAGATGAAGCTTCTTCA; gRNA2:TCAACCGTCCCTGCAAGGCT...TCAACCGTCCCTGCAAGGCT 72623 cut S. pyogenes 26493208 Guigo, Johnson Malat1 H. sapiens gRNA1: GAAACCTCGTGTAGCTATCA; gRNA2: ...

  13. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...Human Bradley 3rd ~9 pairs/exon 9,508 Mouse CRISPR Proximal Poly(A) Site Knockout Library 190744 Knockout ... 6 Varies Enriched subpools (kinase, nuclear, ribosomal, cell cycle) 51043 — 51048 Knockout Human Sabatini...Pan-Druggable Cancer Library 182133 Knockout Human Mali 3rd 1 74 Perturb-seq Guide Barcodes (GBC) 85968 ...

  14. CRISPR Plasmids - dCas9-FokI

    Type
    Collection
    ... available for expression in mammalian systems and Drosophila. Mammalian ID Plasmid Gene/Insert Promoter...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...

  15. Plasmids for Stem Cell Research

    Type
    Collection
    ...tracking of reprogramming factors Fluorescent tagged episomals for stoichiometric induced pluripotent stem cell...Fibroblasts Cholinergic Neurons Lentiviral Human Small molecules enable neurogenin 2 to efficiently convert... Cell Rep. 2016 Jan 5;14(1):115-28. Zhang Adult Dermal Fibroblasts Neurons Lentiviral Human REST suppression...

  16. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ... for epigenetic modification in mammalian or plant systems. Mammalian ID Plasmid Gene/Insert Promoter ...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...

  17. CRISPR Plasmids - Repress Gene Expression

    Type
    Collection
    ...available for expression in mammalian systems, bacteria, plants, and yeast. Mammalian ID Plasmid Gene/Insert...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...

  18. CRISPR Plasmids - Activate Gene Expression

    Type
    Collection
    ...for expression in mammalian systems, bacteria, Drosophila, plants, and yeast. Mammalian ID Plasmid Gene/...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...

  19. CRISPR Plasmids - Single-Strand Break (Nick)

    Type
    Collection
    ...for expression in mammalian systems, bacteria, Drosophila, plants, and yeast. Mammalian ID Plasmid Gene/...Libraries gRNAs Empty gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish...

  20. Fluorescent Protein Guide

    Type
    Collection
    ...conformational changes within a protein. Biosensors Monitor small biomolecules or other physiological intracellular...Chemogenetics Guide | Chemogenetics Plasmids Use small molecules to activate or inhibit genetically engineered... study molecular processes in organs and whole mammals. Michael Davidson Fluorescent Protein Collection...
Showing: 41 - 60 of 817 results