Skip to main content

We narrowed to 681 results for: RON

Showing: 661 - 680 of 681 results
  1. Chemogenetics Guide

    Type
    Guide
    ...control of neuronal activity. Table 1: Descriptions of DREADDs and their activity in neurons DREADD Receptor... and outcome in neurons. Table 2: Descriptions of PSAMs and their activity in neurons PSAM Ion Pore Domain...influx Neuronal activation Magnus et al., 2019 PSAM Q79G,Q139G Gly PSEM 22S Cl - influx Neuronal inhibition...influx Neuronal activation Magnus et al., 2011 PSAM L141F,Y115F Gly PSEM 89S Cl - influx Neuronal inhibition...expressed. However, neuronal control through PSAMs and LMOs is direct, while neuronal control of DREADDs...Specificity hSyn1, CaMKIIa Neurons GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression... for Neuroscientists. Neuron, 89 (4), 683–694. https://doi.org/10.1016/j.neuron.2016.01.040 PMID: 26889809...
  2. Optogenetics Guide

    Type
    Guide
    ...illumination, allowing activity; Dronpa145N homotetramerizes, Dronpa145K and Dronpa145N dimerize with each other...specific subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and ... silence neuronal activity 632 Halo/NpHR Light-driven inward chloride pump from Natronomonas pharaonis... Name Description Peak excitation λ (nm) Dronpa Mutant Dronpa domains associate in the dark, inhibiting...expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated by the... tools are particularly useful for controlling neuronal activity, but they can be deployed to interrogate...channelrhodopsin fused to mCherry is expressed in neurons (red dots). When exposed to light of the correct...
  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...access to projection neurons . Neuron, 92 (2), 372–382. https://doi.org/10.1016/j.neuron.2016.09.021 (Link...injection. Different AAV serotypes exhibit strong neuronal tropism, meaning they can efficiently target...to express fluorescent proteins, often under strong neuron-specific promoters or neural Cre-dependent expression... between neurons within the brain. Large-scale examples of mapping the brain through neuronal tracing ...post on using AAV for neuronal tracing . Browse AAV vectors for monosynaptic neuronal tracing available at...therefore non-pathogenic and generally do not trigger a strong immune response. These features have made AAVs ... contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need...
  4. Promoters

    Type
    Guide
    ...have complex systems of gene regulation, like operons. Operons are a cluster of different genes that are ...transcription. The Lac operon in bacteria is an example of a negatively-controlled operon (Figure 3). A positive-repressible...positive-repressible operon works in the opposite way. The operon is normally transcribed until a repressor...an example of a positively-controlled operon. Figure 3: Lac operon regulation. Created with BioRender.com...arabinose metabolic operon trp Repressible by tryptophan Promoter from E. coli tryptophan operon Ptac Constitutive...Constitutive Insect Strong promoter from baculovirus CAG Constitutive Mammalian Strong hybrid promoter; ...Constitutive Mammalian Strong promoter from human cytomegalovirus EF1a Constituitve Mammalian Strong promoter from...
  5. Lentiviral Vector Guide

    Type
    Guide
    ... contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need...Lentiviral Vectors Addgene's Viral Protocols References Cronin, J., Zhang, X., & Reiser, J. (2005). Altering the...Zufferey, R., Kelly, M., Mandel, R. J., Nguyen, M., Trono, D., & Naldini, L. (1998). A Third-Generation Lentivirus...j.omtm.2020.10.012 PMID: 33768124 Marshall, H. M., Ronen, K., Berry, C., Llano, M., Sutherland, H., Saenz... D., Mulligan, R., Gage, F. H., Verma, I. M., & Trono, D. (1996). In vivo gene delivery and stable transduction...., Somerville, R. P., Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide profiling of retroviral...R. J., Bukovsky, A., Quiroz, D., Naldini, L., & Trono, D. (1998). Self-Inactivating Lentivirus Vector ...
  6. Adenovirus Guide

    Type
    Guide
    ...recognizes adenoviral elements rapidly and can mount a strong immune response quickly, which has limited their... contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need...double-stranded circular episomes. Due to this, and to the strong host’s immune response against the transduced cells...viral vector uptake and transgene expression. This strong immune response has become a disadvantage for the.... They are highly immunogenic and can trigger a strong immune response to researchers if exposed. There...vector capsid. Icosahedral Having the shape of a polyhedron with 20 faces, each being an equilateral triangle...process where bacteria take up DNA from their environment. Tropism The specific types of cells and tissues...
  7. Sequencing Primers

    Type
    Guide
    ...Reverse Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron Forward Bglob-intron-R TTTGCCCCCTCCATATAACA...TTTGCCCCCTCCATATAACA Rabbit beta-globin intron Reverse Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin polyA... pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids Forward pCasper-F GGGTTTTATTAACTTACAT...pMT2-F TTGCCTTTCTCTCCACAGGT 3' end of synthetic intron Forward pMX-S1811 GACGGCATCGCAGCTTGGATACAC MMLV...
  8. Modular Cloning Guide

    Type
    Guide
    .... MoClo Plant Parts Kit Plant Expression Nicola Patron 95 standardized parts specific for plant synthetic...microbes. AspFlex Kit Bacterial Expression, CRISPR Veronica Godoy-Carter Plasmids for protein expression and...MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 Genome Engineering, CRISPR Sylvestre Marillonnet...constructs are made with zCas9i, a high efficiency intron-optimized SpCas9-coding gene. MoClo CRISPR/Cas ...Resources Guide to DNA Assembly Techniques by Nicola Patron at The Sainsbury Laboratory Weber E, Engler C, ... M, Gruetzner R, Ehnert TM, Werner S, Jones JD, Patron NJ, Marillonnet S. A golden gate modular cloning...
  9. Antibody Guide

    Type
    Guide
    ... more expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell...antigen. Polyclonal antibodies are often more environmentally stable and more cost-effective. They are useful...are synthetic binding proteins which use the Fibronectin type III domain as their scaffolding instead ...does not use cross-linking and instead relies on strong interactions between DNA and protein. Micrococcal...for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ChIP ...different antibodies and do batch validation up front rather than risk delaying a process through sequential...
  10. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... contains many viral vector-specific terms and acronyms, so if you're new to viral vectors or simply need...Wang, W., Carpenter, E., Mason, A., Wong, G. K., Cameron, E. R., Kilbey, A., & Neil, J. C. (2016). Gamma-Retrovirus...2014). MLV integration site selection is driven by strong enhancers and active promoters. Nucleic Acids Research...Merget-Millitzer, H., Engelstädter, M., Kurth, R., Groner, B., & Cichutek, K. (1997). Pseudotyping of murine...process where bacteria take up DNA from their environment. Tropism The specific types of cells and tissues...
  11. CRISPR Guide

    Type
    Guide
    ...general repair pathways: the efficient but error-prone non-homologous end joining (NHEJ) pathway and the...to the desired edit can increase efficiency. Synchronizing cells or modulating the cell cycle can help ...exhibit almost unidirectional insertions but are more prone to off-target insertions. And in the case of both...differentiation. The system is reversible, with a companion CRISPRon to undo repression using a TET1-dCas9 fusion. ... Gelsinger, D. R., Vo, P. L. H., Klompe, S. E., Ronda, C., Wang, H. H., & Sternberg, S. H. (2024). Bacterial.... 41 (7), 968–979. PMID: 36593413 Vo, P. L. H., Ronda, C., Klompe, S. E., Chen, E. E., Acree, C., Wang...
  12. Guide to Using Pooled Libraries

    Type
    Guide
    ... such as barcoding or targeting RNA. Advantages Strong, specific loss of function (knockout) or gain-of-function...created from genomic DNA. Since cDNA libraries lack introns and other nontranscribed sequences, they are smaller...discovery, and functional complementation. Advantages Strong and uniform overexpression Independent of chromatin...survive selection. The selective pressure must be strong enough that most of the cells die, removing their...
  13. Plan Your Experiment

    Type
    Guide
    ...Permanently disrupt gene function; cells will use error-prone non-homologous end joining (NHEJ) at the cut site...mutated allele may be different owing to the error-prone nature of NHEJ . In HDR , base editing , or prime...
  14. Science Guides

    Type
    Guide
    ...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...
Showing: 661 - 680 of 681 results