... generated by directly injecting DNA into the pronuclei of fertilized eggs, which leads to random incorporation...

... by various types of interactions with their environment. These types of interactions to a large extent...

...parallelization (7) have allowed for real-time monitoring of neuronal activity across substantial 3D volumes. In addition...

...protocol available at the (Link opens in a new window) Trono lab website . Viral Production Schematic Frequently...species and cell types. For more information, see the Cronin, et al. article on different envelopes and their...protocol for using the popular cloning vector pLKO.1. Trono Lab Resources: Lentivectors Toolbox and Maps Standard...tropism of lentiviral vectors through pseudotyping. Cronin J, Zhang XY, Reiser J. Curr Gene Ther. 2005. 5(... by Retroviral Vectors. Zufferey R, Donello JE, Trono D, and Hope TJ. J Virol. 1999. 73(4):2886-92. PubMed...Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, and Naldini L. J Virol. 1998. 72(11):8463-8471...Mandel RJ, Bukovsky A, Quiroz D, Naldini L, and Trono D. J Virol. 1998. 72(12): 9873-9880. PubMed . Retroviruses...

... with highly repetitive sequences (which can be prone to recombination in bacteria) such as lentiviral...

...primer Bglob-intron-F CTGGTCATCATCCTGCCTTT Rabbit beta-globin intron, forward primer Bglob-intron-R TTTGCCCCCTCCATATAACA...TTTGCCCCCTCCATATAACA Rabbit beta-globin intron, reverse primer Bglob-pA-R TTTTGGCAGAGGGAAAAAGA Rabbit beta-globin... pCAG-F GCAACGTGCTGGTTATTGTG Rabbit beta-globin intron, for pCAG plasmids, forward primer pCasper-F GGGTTTTATTAACTTACAT...pMT2-F TTGCCTTTCTCTCCACAGGT 3' end of synthetic intron, forward primer pMX-S1811 GACGGCATCGCAGCTTGGATACAC...

... more expensive than polyclonal antibodies. Environmental factors, binding partners, location in the cell...antigen. Polyclonal antibodies are often more environmentally stable and more cost-effective. They are useful...are synthetic binding proteins which use the Fibronectin type III domain as their scaffolding instead ...does not use cross-linking and instead relies on strong interactions between DNA and protein. Micrococcal...for DNA:histone modifier interactions, which have strong binding between the protein and DNA. Some ChIP ...different antibodies and do batch validation up front rather than risk delaying a process through sequential...

...general repair pathways: the efficient but error-prone non-homologous end joining (NHEJ) pathway and the...to the desired edit can increase efficiency. Synchronizing cells or modulating the cell cycle can help ...exhibit almost unidirectional insertions but are more prone to off-target insertions. And in the case of both...differentiation. The system is reversible, with a companion CRISPRon to undo repression using a TET1-dCas9 fusion. ... Gelsinger, D. R., Vo, P. L. H., Klompe, S. E., Ronda, C., Wang, H. H., & Sternberg, S. H. (2024). Bacterial.... 41 (7), 968–979. PMID: 36593413 Vo, P. L. H., Ronda, C., Klompe, S. E., Chen, E. E., Acree, C., Wang...

...only a subset of genes, or very large (e.g. the Toronto KnockOut (TKO) library from the Moffat lab has ... post-selection. The selective pressure must be strong enough that most of the cells die, removing their...

...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...

... as alter tropism. For example, AAV2/5 targets neurons that are not efficiently transduced by AAV2/2, ...

...mutated allele may be different owing to the error-prone nature of NHEJ. In HDR gene editing experiments,...

...controlling the level of insert expression (i.e., a strong promoter directs high expression, whereas weaker...