Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 114 results for: CHL

Showing: 91 - 114 of 114 results

  2. Synthetic Biology - Overview

    Type
    Collection
    ...Balazsi Matthew Bennett Carolyn Bertozzi Nicolas Buchler George Church Cynthia Collins James Collins Tom...

  3. Microbiology Resources

    Type
    Collection
    ...Burkholderia sp. Bordetella pertussis Campylobacter sp. Chlamydia sp. Clostridium sp. Deinococcus radiodurans Enterococcus...

  4. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...Marraffini 42876 pCas9 BsaI E. coli, S. pneumoniae Chloramphenicol yes, cut Marraffini 44251 pgRNA-bacteria BBa_J23119...

  6. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...Knockout Human Garnett 3rd 2 37,722 Green monkey (Chlorocebus sabaeus) sgRNA library 178284 Knockout Green ...

  7. Handling Plasmids from Addgene - Purifying Plasmid DNA

    Type
    Protocol
    ...mL RNase A TE or water-saturated phenol-chloroform Chloroform 100% ethanol or isopropanol 90% ethanol ...: Perform phenol-chloroform extraction - see protocol below . Note: Phenol-chloroform extraction removes...Phenol-Chloroform Extraction of DNA Samples Add an equal volume of TE-saturated phenol-chloroform to the...volume of chloroform to the recovered aqueous DNA layer. Repeat steps 2-4. Note: Phenol-chloroform is a hazardous...aqueous DNA sample. Pro-Tip Water-saturated phenol-chloroform can be used if TE-saturated is not available....without a kit it is advisable to perform a phenol/chloroform extraction of the supernatant after step 6 and...

  8. General Transfection

    Type
    Protocol
    ...56 °C for 30 min. 25 mM chloroquine diphosphate Dissolve 0.129 g of chloroquine diphosphate salt into 10...slowly add hydrochloric acid until the solution clears. Check the pH of the solution Use hydrochloric acid ... Opti-Pro SFM, Thermo Fisher, 12309019 25 mM chloroquine Polyethylenimine, linear MW 25,000 Da Microcentrifuge....X 10 cm tissue culture dish, Corning 430167 Hydrochloric acid Sodium hydroxide 0.22 μm polyethersulfone... will be basic and will need adjustment with hydrochloric acid first. Pro-Tip The pH of this solution ...add 10 mL fresh DMEM complete containing 25 µM chloroquine diphosphate and incubate ~5 h For 10 mL of DMEM...DMEM complete, add 10 µL of 25 mM chloroquine diphosphate. Dilute 18.9 µg of DNA into 500 µL of Opti-Pro...

  9. Cre-lox system

    Type
    Collection
    ... Ko 139670 pTFUbiCre Cre Maize Ubiquitin Plant Birchler 140131 pAAV-EF1a-NCreV N-terminal Cre component...

  10. Kit Free RNA Extraction

    Type
    Protocol
    ...are also included: using Isopropanol or Lithium Chloride. This protocol was adapted from (Link opens in...Water-saturated Phenol 2 M Sodium Acetate pH 4 Chloroform/Isoamyl alcohol (49:1) 75% Ethanol RNase-free...for precipitation step, Option A) 7.5 M Lithium Chloride (for precipitation step, Option B) Glycogen (Optional...phenol, mix thoroughly by inversion. Add 0.2 mL of Chloroform/Isoamyl alcohol (49:1) and then shake vigorously...(s). You can use either Isopropanol or Lithium Chloride for this step. Isopropanol (Option A): Add 1 volume...aqueous layer. Incubate at -20°C for 1 hour. Lithium Chloride (Option B): LiCl selectively precipitates RNA ...from the homogenized sample(s). Add 0.2 mL of Chloroform/Isoamyl alcohol (49:1) per 1 mL of TRIzol® used...

  11. Lentivirus Production

    Type
    Protocol
    ... add hydrochloric acid until the solution clears. Check the pH of the solution. Use hydrochloric acid ... Opti-Pro SFM, Thermo Fisher, 12309019 25 mM chloroquine Polyethylenimine, linear MW 25,000 Da Heat-inactivated...Corning 430167 15 mL conical tubes, VWR 21008-216 Hydrochloric acid Sodium hydroxide 0.22 μm polyethersulfone... will be basic and will need adjustment with hydrochloric acid first. Pro-Tip The pH of this solution ...mL conical and an appropriate amount of 25 mM chloroquine to the conical so that the final concentration...transfection mixes are added) will be 25 uM of chloroquine. After the incubation, add the DNA:PEI-Max mix...mix to the conical containing the media and chloroquine and mix well. Gently aspirate the media out of...

  12. AAV Production in HEK293 Cells

    Type
    Protocol
    ...add hydrochloric acid until the solution clears. Check the pH of the solution and use hydrochloric acid... pH 8.5 + 60 mL of 5 M Sodium Chloride + 4 mL of 1 M Magnesium Chloride Close the bottle and mix by inverting...

  13. Affinity Purification of Recombinant Antibodies with Protein A or Protein G

    Type
    Protocol
    ...dibasic, Millipore Sigma S7907-500G 1 M Trizma hydrochloride solution pH 9.0, Millipore Sigma T2819-1L 250...binding buffer 2x . Add 50 µL of 1 M Trizma hydrochloride pH 9.0 to 10 microcentrifuge tubes. Cap the ... into the tubes containing 50 µL 1 M Trizma hydrochloride pH 9.0. Cap the tubes and vortex for 5 s to ...

  14. Transfection for Recombinant Antibodies

    Type
    Protocol
    ...salt, Sigma Aldrich P4543-10G Polyethylenimine hydrochloride, M.W. 40000 (PEI-MAX), Linear, Transfection ...7.0 with 10 N sodium hydroxide (NaOH) or 5 N hydrochloric acid (HCl). Note: Adjust the pH slowly, adding...

  15. Pouring LB Agar Plates

    Type
    Protocol
    ...extract 10.0 g peptone from casein 10.0 g sodium chloride 12.0 g agar-agar 1 L Sterile H 2 O Sterile plates...5 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Coumermycin...

  18. Optogenetics Guide

    Type
    Guide
    ... mutations 540 Channelrhodopsins: chloride channels iChloC Chloride-conducting channel, CrChR2 with mutations...species include: CsChR (from Chloromonas subdivisa ), CoChR (from Chloromonas oogama ), and SdChR (from ...channels from Chlamydomonas reinhardtii ChR2 Widely used light-gated cation channel from Chlamydomonas reinhardtii...Channelrhodopsin from Chloromonas oogama CsChR Channelrhodopsin from Chloromonas subdivisa CheRiff Channelrhodopsin...channelrhodopsins were discovered in the green algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited...identified in other species - by acting as light-gated chloride channels, these variants result in the hyperpolarization...include: Increased photocurrent amplitude Examples: iChloC, SwiChRca, Phobos, Aurora Browse Channelrhodospin...

  20. Chemogenetics Guide

    Type
    Guide
    ... alternative DREADD ligands. Compound 21, Deschloroclozapine (DCZ), Perlapine, and Olanzapine have all...pair a PSAM domain with a Glycine-receptor (GlyR) chloride-selective IPD. Binding of the cognate PSEM allows...Higuchi M, Jin J, Roth BL, Minamimoto T (2020). Deschloroclozapine, a potent and selective chemogenetic actuator...

  21. CRISPR Guide

    Type
    Guide
    ...alternatives Abudayyeh, O. O., Gootenberg, J. S., Essletzbichler, P., Han, S., Joung, J., Belanto, J. J., Verdine...Gootenberg, J. S., Abudayyeh, O. O., Lee, J. W., Essletzbichler, P., Dy, A. J., Joung, J., Verdine, V., Donghia..., O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., Van Der Oost, ...

  22. Lentiviral Vector Guide

    Type
    Guide
    ..., M., Sutherland, H., Saenz, D., Bickmore, W., Poeschla, E., & Bushman, F. D. (2007). Role of PSIP1/LEDGF...science.272.5259.263 PMID: 8602510 Schambach, A., Zychlinski, D., Ehrnstroem, B., & Baum, C. (2013). Biosafety...

  23. Sequencing Primers

    Type
    Guide
    ...primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward...

  24. Molecular Biology Reference

    Type
    Guide
    ...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Hygromycin...
Showing: 91 - 114 of 114 results