We narrowed to 86 results for: alp;
-
TypeProtocol...ligation reaction into competent cells such as DH5alpha or TOP10. If using much less total DNA (<1ng...
-
Plasmid Cloning by PCR (with Protocols)
TypeProtocol...ligation reaction into competent cells such as DH5alpha or TOP10. If using much less total DNA (<1ng) ... -
Lentivirus Plasmids
TypeCollection...cloned into the plasmid. Nolan 12257 pWPXL 2nd EF-1alpha driven constitutive transgene expression, contains...gives you high expression. Trono 12254 pWPI 2nd EF-1alpha driven constitutive transgene expression and EGFP...EGFP coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...similar plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin Microtubules 87422 LMNB1-mEGFP AICSDP-10...Peroxisomes 101785 TUBA1B-mTagRFP-T AICSDP-28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1-mEGFP AICSDP...Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T... -
Validated gRNA Sequences
TypeCollection...Moffat AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...Shaw AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...Rtn4a-GFP (tubular ER) Microtubules mCherry-alpha-tubulin Early Endosome Vacuolar Compartment... -
MAPK Plasmids
TypeCollection...PRKM8, SAPK1, SAPK1c MAPK9 JNK-55, JNK2, JNK2A, JNK2ALPHA, JNK2B, JNK2BETA, PRKM9... PRKM15, RK, SAPK2A, p38, p38ALPHA MAPK15 ERK7, ERK8 *Image is licensed under the... -
Institute for Protein Innovation
TypeCollection... of mechanotransduction receptors, comprised of alpha-beta subunit heterodimers. The IPI collection contains...contains antibodies that uniquely: Bind to the alpha subunit, outside the ligand-binding pocket Bind to... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...13421 pAC-Kan-alphaGal4 13422 pBAC-lacZ 13424 KJBAC1 strain 21869 pKJ1267 (aka pAC-alphaGal4) 21870 pKJ1712... -
Synthetic Biology - Overview
TypeCollection...Blog Genome Engineering SynBio Depositing Labs Hal Alper J. Chris Anderson Adam Arkin Gabor Balazsi Matthew...Mammalian Worm Fungal Algal Featured SynBio Deposits Alper Lab Y. Lipolytica Promoters Anderson Lab Plasmids... -
Ras Pathway
TypeCollection... PPP1CA Protein phosphatase 1 catalytic subunit alpha PREX2 Phosphatidylinositol-3,4,5-trisphosphate-dependent... kinase AMP-activated: A1,A2: Catalytic subunit alpha B1,B2: non-catalytic subunit beta G1, G2, G3: non-catalytic... -
Brzezinski Lab CRISPR Collection
TypeCollection...modifications: replacement of the Cbh promoter with EF1alpha addition of an mCherry reporter variant nuclear... -
mTOR Pathway
TypeCollection...catalytic and regulatory subunits - Class I PKC PKC alpha PKC beta PKC delta PKC epsilon PKC gamma PKC eta... -
p53 Pathway
TypeCollection...GADD45G Growth arrest and DNA-damage-inducible; alpha, beta, or gamma IGF-BP3 Insulin-like growth factor... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...-shRNA3 72598 Expresses shRNA against mouse TNF-alpha mRNA from the mouse U6 promoter pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro... -
Open Enzyme Collection
TypeCollection...Drosophila 165580 pOpen-BovDNTT Bovine DNTT 165555 pOpen-ALPI CIP (calf intestinal phosphatase) Return to top ... -
Neurodegeneration Research Collection
TypeCollection... and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al. Sci Rep. 2023 Oct 18. ... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGCTTTCACGCATTGCACtacacattggcaagatgGCAGCCACCATCGGGAGA prothymosin alpha a TAL3344 & TAL3345 TTATCATTCGCATCTCGTatttctctttatattaTTTTATTCCGAGACCCCA... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Lentiviral BsmBI yes, cut S. pyogenes Jacks pU6-sgRNA EF1Alpha-puro-T2A-BFP 60955 Mammalian/Lentiviral none S... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Acid Linkers between a Fluorescent Protein and PDE5alpha. ACS Sens. 2017 Jan 27;2(1):46-51. Tetsuya Kitaguchi...