Skip to main content

We narrowed to 873 results for: LIC

Showing: 861 - 873 of 873 results
  1. CRISPR Guide

    Type
    Guide
    ...Experiment Web References PAM Sequences Glossary Publications CRISPR Overview Bacteria have an interesting... every genomic target. Due to its comparative simplicity and adaptability, CRISPR rapidly became the most... to various Cas enzymes have extended CRISPR applications to increasingly complex functions, including...understanding of CRISPR biology, introduce the various applications of CRISPR, and help you get started using CRISPR... Cas12a, which are available for specialized applications. Check out our list of additional Cas proteins...genomic edits carried out by Cas9. Multiplexing applications include editing multiple genes at once; using...to help you select an optimized gRNA for your application (see: gRNA Design Software ). In addition to ...
  2. Lentiviral Vector Guide

    Type
    Guide
    ... Rev Response Element (RRE) within unspliced and partially spliced transcripts to facilitate nuclear export...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery...of safety improvements and the potential for replication-competent lentivirus production — that is, creation...particles that could infect cells and further replicate on their own. While the viral components are still...Interchangeable; usually encodes for VSV-G Safety Safe; replication incompetent by using three separate plasmids ...plasmids encoding the necessary viral genes Safer; replication incompetent by using four plasmids instead of ...
  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...and tropism. Replication-competent The ability of a virus (or viral vector) to replicate and reproduce...hosts in order to continue their lifecycle and replicate. This feature can be harnessed for stable delivery... for safety to reduce the chance of creating replication-competent retroviruses. For a summary of all ...retroviral vectors are commonly used in gene therapy applications to more specifically direct delivery of gene...vectors are a popular choice in gene therapy applications. There are many approved gamma-retroviral gene...cell (CAR-T) therapy is a particularly popular application of gamma-retroviral vectors. Gamma-retroviral...vectors are: The potential for generation of replication-competent gamma-retroviral vectors The potential...
  4. Modular Cloning Guide

    Type
    Guide
    ...a variety of applications—like building synthetic genetic circuits, engineering metabolic pathways, assembling...Modular Cloning Blog: Plasmids 101 Modular Cloning Applications and Kits Blog: Plasmids 101 Golden Gate Cloning...editing, functional genomics, and more complex metabolic engineering and synthetic biology, compatible ...proteins for use in E. coli for a variety of applications. EcoFlex MoClo Extension, Volume I Bacterial... vectors for use in E. coli for a variety of applications. CIDAR MoClo Parts Kit Bacterial Expression ...toolkit with both high cloning capacity and vector simplicity, compatible with other MoClo, GoldenBraid, and...multi-part assemblies in either integrative or self-replicating plasmid vectors for working in cyanobacteria....
  5. Addgene's eBook Collection

    Type
    Guide
    ...contains an introduction to each vector and its applications, tips for using vectors in your experiments,...your transferable skills, and tips on the job application process. Close About Overlay Select CRISPR 101...introductions and helpful tips for antibody-based applications, from flow to IHC! Close About Overlay 0 of ...
  6. Guide to Using Pooled Libraries

    Type
    Guide
    ..., semi-random sequences that can be used for applications like lineage tracing or parsing the effects ...library screens, cells are infected at a very low multiplicity of infection (MOI) to increase the odds that...of each cell carrying it as being a biological replicate for that plasmid. Library screens can be divided...
  7. Plan Your Experiment

    Type
    Guide
    ...component for each category. Genetic Manipulation Application Cas Enzyme Additional Considerations Browse Plasmids...gene you target will depend on your specific application. Knockout : Target constitutively expressed regions...region is removed from the mRNA due to alternative splicing, and an early frameshift mutation is more likely...
  8. Sequencing Primers

    Type
    Guide
    ...SV40 promoter/origin Forward SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence Reverse T3 GCAATTAACCCTCACTAAAGG...
  9. Chemogenetics Guide

    Type
    Guide
    ...neurons) that can be turned on or off by the application of a small molecule ligand. The ideal chemogenetic...chemogenetics for research and potential clinical applications. Science, 364 (6436), eaav5282. https://doi....
  10. Optogenetics Guide

    Type
    Guide
    ...conformation/dimerization. In addition to the applications described above, both LOV and Dronpa can control...Arabidopsis thaliana is fused to truncated forms of cytosolic STIM1 to control calcium channels ~488 LOV domains...
  11. Educational Resources

    Type
    Guide
    ...written and video protocols for a wide range of applications in molecular biology, plasmid cloning, and virus...
  12. Science Guides

    Type
    Guide
    ...specific binding to other proteins. Antibody-based applications, which often use antibodies conjugated to a ...
  13. Promoters

    Type
    Guide
    ...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ...
Showing: 861 - 873 of 873 results