Skip to main content
Addgene

We narrowed to 870 results for: LIC

Showing: 861 - 870 of 870 results
  1. Modular Cloning Guide

    Type
    Guide
    ...a variety of applications—like building synthetic genetic circuits, engineering metabolic pathways, assembling...Modular Cloning Blog: Plasmids 101 Modular Cloning Applications and Kits Blog: Plasmids 101 Golden Gate Cloning...editing, functional genomics, and more complex metabolic engineering and synthetic biology, compatible ...proteins for use in E. coli for a variety of applications. EcoFlex MoClo Extension, Volume I Bacterial... vectors for use in E. coli for a variety of applications. CIDAR MoClo Parts Kit Bacterial Expression ...toolkit with both high cloning capacity and vector simplicity, compatible with other MoClo, GoldenBraid, and...multi-part assemblies in either integrative or self-replicating plasmid vectors for working in cyanobacteria....
  2. Addgene's eBook Collection

    Type
    Guide
    ...contains an introduction to each vector and its applications, tips for using vectors in your experiments,...your transferable skills, and tips on the job application process. Close About Overlay Select CRISPR 101...introductions and helpful tips for antibody-based applications, from flow to IHC! Close About Overlay 0 of ...
  3. Guide to Using Pooled Libraries

    Type
    Guide
    ..., semi-random sequences that can be used for applications like lineage tracing or parsing the effects ...library screens, cells are infected at a very low multiplicity of infection (MOI) to increase the odds that...of each cell carrying it as being a biological replicate for that plasmid. Library screens can be divided...
  4. Sequencing Primers

    Type
    Guide
    ...promoter/origin, forward primer SV40-spliceR CACAAAGATCCGGACCAAAG SV40 splice sequence, reverse primer T3 GCAATTAACCCTCACTAAAGG...reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG (Orsulic lab) 3' of Rous sarcoma virus (RSV) env gene, forward...
  5. Plan Your Experiment

    Type
    Guide
    ...component for each category. Genetic Manipulation Application Cas Enzyme Additional Considerations Browse Plasmids...gene you target will depend on your specific application. Knockout : Target constitutively expressed regions...region is removed from the mRNA due to alternative splicing, and an early frameshift mutation is more likely...
  6. Chemogenetics Guide

    Type
    Guide
    ...neurons) that can be turned on or off by the application of a small molecule ligand. The ideal chemogenetic...chemogenetics for research and potential clinical applications. Science. 364(6436):eaav5282. PMID: 30872534...
  7. Optogenetics Guide

    Type
    Guide
    ...conformation/dimerization. In addition to the applications described above, both LOV and Dronpa can control...Arabidopsis thaliana is fused to truncated forms of cytosolic STIM1 to control calcium channels ~488 LOV domains...
  8. Educational Resources

    Type
    Guide
    ...written and video protocols for a wide range of applications in molecular biology, plasmid cloning, and virus...
  9. Science Guides

    Type
    Guide
    ...specific binding to other proteins. Antibody-based applications, which often use antibodies conjugated to a ...
  10. Promoters

    Type
    Guide
    ...Inducible by arabinose Promoter of the arabinose metabolic operon trp Repressible by tryptophan Promoter ...
Showing: 861 - 870 of 870 results