...persist in non-dividing cells for a period of years without damaging the host cell. In contrast, viral particles...through cell lysis. Episomal stability enables long-term transgene expression in non-dividing cells and is... the helper plasmid are transfected into HEK293 cells, which contain the adenovirus gene E1+, to produce...integration can affect the expression of transgenes, as well as the expression of neighboring genes. The short...serotypes differ in their tropism, or the types of cells they infect, making AAV a very useful system for...for preferentially transducing specific cell types. The chart below gives a summary of the tropism of AAV...AAV5, AAV6, AAV9 Pancreas AAV6, AAV8 Photoreceptor Cells AAV2, AAV5, AAV8 RPE (Retinal Pigment Epithelium...

...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector, forward primer...LacZ, reverse primer LexA CGTCAGCAGAGCTTCACCATTG (Caldwell lab) 3' end of LexA DNA binding domain, forward...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...

...describes the specifics of these regions in eukaryotic cells. Core Promoter The core promoter region is located...bind. Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding...element controls the rate of transcription. Bacterial cells contain sigma factors which assist the RNA polymerase...ribosomal RNA (rRNA) which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...

...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Read More...

...1,000 cells into each well of a 6-well dish. Prepare a batch of cells as follows: Dilute 7,000 cells into...polybrene. Mix well by pipetting or inverting. Aliquot 1.35 mL of the cell suspension into each well of the 6... of selection, no cells have survived in the untransduced well, while lawns of cells are present in the...protocol was developed for A549 cells but can be adapted to a variety of target cell lines and selection markers...the cells cannot be used for later experiments. Workflow Timeline Day 0: Seed and transduce cells Day ...health of the target cell line is critical for obtaining accurate titers. Check the cells for mycoplasma (...regularly Do not over or under-grow your cells. Thaw a new vial of cells after 20–30 passages. Do not add penicillin...

... viral dilution to a well of a 6-well plate (1 dilution per well). Leave one well untransduced (add 150...1: Seed and transduce cells Day 4: Treat cells with Benzonase and harvest cells Day 4+: ddPCR and analysis...below). Seed 300,000 cells/well in 1350 µL media and 11.1 µg/mL Polybrene into the wells containing the virus... for 10 wells with 3,000,000 cells in 13.5 mL of media and 11.1 µg/mL Polybrene. Mix the cell suspension...suspension well before seeding. Mix each well with a 1 mL pipette 5–10 times. The final volume in the well is ...the 6-well plates. Be sure to use a new aspirating pipette for each well as to not contaminate cell conditions...pipette for each well. Detach cells by incubating with 200 µL TrypLE for 1–2 min. Resuspend cells in 500 µL ...

...Procedure Seed 75,000 cells into each well of a 6-well dish. Prepare a batch of cells as follows: Dilute ...,000 cells into 14 mL of DMEM complete. Mix well by pipetting or inverting. Aliquot 2 mL of cell suspension...suspension into each well of the 6-well dish. Incubate the cells overnight. If using freshly collected virus...dilutions well Gently aspirate media from the cells. Add 1.5 mL of a viral dilution to each well (each well... well gets one dilution with one well remaining as the untransduced control). Count the cells in the remaining...fluorescent-positive cells in each well. When calculating titer, only consider wells with less than 40% ...: If 150,000 cells were transduced in the 1:100 well, resulting in 25% fluorescent cells, then the titer...

...transfected cells. k. Incubate cells at 37°C, 5% CO 2 for 24 hours. Day 4: l. Harvest media from cells and transfer... infect the target cells. Addition of puromycin will allow you to select for cells that stably express... 7×105 HEK-293T cells in 5 mL of media in a 6 cm tissue culture plate. Incubate cells at 37°C, 5% CO 2...Although cells should regularly be passaged in DMEM + 10% FBS with penicillin/streptomycin, cells should... temperature. g. Retrieve HEK-293T cells from incubator. The cells should be 50-80% confluent and in DMEM...you do not want to dislodge the cells from the plate. i. Incubate cells at 37°C, 5% CO 2 for 12-15 hours...antibiotics to the cells and incubate at 37°C, 5% CO 2 for 24 hours. Day 5: n. Harvest media from cells and pool...

...Workflow Timeline Day 1: Seed cells Day 2: Transfect cells Day 3-6: Feed cells Day 7: Harvest antibody Equipment...10 µL of the cell suspension/trypan blue mix into a cell counting chamber. Load the cell counting chamber...HEK293 cells and media to 50 mL conical tubes. Centrifuge for 15 min at 3100 x g to pellet the cells. Filter...interest in cell culture. This protocol describes how to transfect suspension HEK293 cells with recombinant...Section 1: Seeding cells The day prior to transfecting, seed a 108 mL culture of HEK293 cells at a density ...Pro-Tip Do not use cells that are over 30 passages. Section 2: Transfection Check the cell density and viability...transfer 0.5 mL of HEK293 cell suspension into a clean microcentrifuge tube. Pro-Tip Cells settle quickly and...

... the pellet. Air-dry the pellet for 5-10 minutes. Critical It is important to not let the pellet get too... or cells without a kit. The general steps of this protocol include homogenization/lysis of cells or tissues...lyse tissues or cells in Solution D. For tissues: use 1 mL of Solution D per 100 mg of cells. For cultured...cultured cells: use 1 mL of Solution D per 1 X 10 7 cells. Allow sample(s) to sit at room temperature for 5...effectively lyse open the cells. Extract RNA from the homogenized sample(s).Transfer tissue/cell lysate to a 4 mL...gel-like white pellet of total RNA in the bottom of the tube. Wash the RNA by resuspending the pellet in 0.5–...

...first three wells of each row, using a different standard solution for each row of a 96-well ELISA microplate...remove the plate seal from the 96-well plate and set aside. Aspirate the wells and use a multichannel pipette...Solution directly to the wells to stop the reaction. Measure the absorbance of each well at 450 nm on the spectrophotometer...options available. Caution Use the Stop Solution in a well ventilated area and avoid breathing in the vapors...

... Seeding cells Place a sterile poly-D-lysine coated coverslip in each well of a 24-well cell culture treated...treated plate. Seed 5 x 10 3 HeLa cells per well. Allow the HeLa cells to grow to the desired density before... permeabilizing cells Gently aspirate the media from the 24-well plate. Wash each well with 500 µL of ...detect antigens in cells. Here we describe the basic steps for fixing and labeling cells in culture with ...2022 Workflow Timeline Day 1: Seed cells Day 3-4: Fix and label cells Equipment Pipette controller Pipette...Sterile Poly-D-lysine coated coverslips HeLa cells 24-well plate 4% Paraformaldehyde 5 mg/mL 4′,6-diamidino... the microscope slide with the cell side facing down. Observe the cell labeling on a microscope with appropriate...

...such as stable-cell line generation. Workflow Timeline Day 0: Seed 293T packaging cells Day 1 (pm): Transfect...and for each cell line. Considerations Before You Start The health of the packaging cell line is critical... viral titer. 293T cells should be split 3 times a week: Monday: Plate 1×10 6 cells in a T75 flask in ...: Plate 1×10 6 cells in a T75 flask in 15 mL DMEM Complete. Friday: Plate 8×10 5 cells in a T75 flask .... Use cells that are below passage 15 for viral production. Procedure Seed 293T packaging cells at 3.8....8×10 6 cells per plate in DMEM Complete in 10 cm tissue culture plates. Incubate the cells at 37 °C, ...prepared, transfect cells with a fluorescent plasmid using a variety of ratios. Check the cells 1-2 days after...

... of HEK293T cells optimized for viral production (AAVpro or Lenti-X), but any HEK293T cell line should...different cell lines and different transfection reagents. Workflow Timeline Day 0: Seed HEK293T cells (or a... health of the cell line is critical for obtaining high levels of virus. HEK293T cells should be split...Plate 1x10 6 cells in a 75 cm 2 flask in a volume of 15 mL. Wednesday: Plate 1x10 6 cells in a T75 flask...8x10 5 cells in a T75 flask in a volume of 15 mL. Do not add antibiotics to the media. Use cells that are...PEI determined. Procedure Seed HEK293T cells at 3.8x10 6 cells per plate in DMEM complete in 10 cm tissue...prepared, transfect cells with a fluorescent plasmid using a variety of ratios. Check the cells 1–2 days after...

... minutes) to pellet bacteria. Decant LB and weigh pellet. The total weight of each pellet should be ~1...limited. Day 2: Harvest cells and purify DNA (Estimated time 3-4 hours) Cells should be harvested first...electrocompetent cells (Default: 4 tubes of Endura Duos, Lucigen, 60242-1) Alternatives include Stbl4 cells or other...Maxipreps rely on incremental, ordered cell lysis. E. coli cells are subject to lysis by freeze-thaw if...Ensure that electrocompetent cells are being used. Chemically competent cells will not provide adequate ...CRISPR pooled plasmid libraries in Escherichia coli cells. Protocols...of a pooled-plasmid library in Escherichia coli cells. Pooled libraries contain tens to millions of different...

...commonly referred to as 'competent cells.' Many companies sell competent cells, which come frozen and are prepared...that came with your competent cells. Pro-Tips Commercial competent cells range significantly in their ...SOC media Competent cells DNA you'd like to transform Procedure Take competent cells out of -80°C and thaw...use electro-competent cells. Instead of relying on the heat-shock to cause the cells to take up the DNA,...process by which foreign DNA is introduced into a cell. Transformation of bacteria with plasmids is important... all plasmids (even those designed for mammalian cell expression) carry both a bacterial origin of replication...transformation efficiency. The lowest efficiency cells (usually the least expensive) are fine for transforming...

...a mouse. Procedure Section 1: Lyse cells Centrifuge 5 x 10 6 cells for 5 min at 100 x g . Gently remove...remove supernatant. Resuspend cell pellet in 1 mL of 1X PBS and transfer to a microcentrifuge tube. Centrifuge... g . Carefully remove supernatant. Resuspend cell pellet in appropriate volume of cold lysis buffer. Pro-Tips...buffer will vary depending on the size of your cell pellet but will generally be between 250–1000 µL . The...This protocol describes the basic steps for lysing cells, determining total protein concentration in the ...use western blotting to visualize a protein from cells or tissue samples. Equipment Microcentrifuge 0.5...

... Wash the pellet or column with 70% ethanol to remove excess salt. Resuspend the DNA pellet, or elute ...careful not to disturb the bacterial pellet. Resuspend the pellet in 100 μL of cold Solution I. Vortex... tube for 5 min at 12,000 g. Notes: Pellet contains proteins, cell fragments, salt and other extra particles...Optional Wash the pellet with 70% ethanol. Note: This step removes excess salt from the pellet which can cause...the sink. Pro-Tip Be careful, the pellet is harder to see and less well attached to the tube after the 70%...Invitrogen , and (Link opens in a new window) Promega sell kits for isolating plasmid DNA in quantities as ...require larger cultures). Centrifuge the culture to pellet the bacteria before proceeding with DNA preparation...

...Axygen, PCR-02-FCP-C ddPCR 96-well PCR plates, Bio-Rad, 12001925 48-well dilution plate, Bio-Rad, MLL4801...the 96-well plate sealer by gently touching the screen. Prepare the Serial Dilution Place a 48-well dilution...10 sec before use. Place an 8-well PCR tube strip into a chilled 96-well freezer block. Add 20 µL of the...touch the bottom of the well. Lift the tips ~1 mm. Touch the side of the well and tilt the pipette tips...Centrifuge, Thermo Scientific, 10199-452 Ice bucket 96-well freezer blocks (x 3) Reagents Molecular Biology ...dilution plate in a chilled 96-well freezer block and place in the dilution BSC. Prepare 1X dilution buffer... µL of each viral sample to Dilution 1 in the 48-well dilution plate and pipette 5–10 times to mix. Dilute...

...Generating Stable Cell Lines with Lentivirus Genomically integrate your DNA sequence into a cell line Isolating...Isolating a Monoclonal Cell Population by Limiting Dilution Generate monoclonal cell lines from a polyclonal...polyclonal pool of stable cells AAV Production in HEK293 Cells Produce adeno-associated virus to deliver your...Extraction Without a Kit Extract RNA from tissues or cells without a commercial kit Plasmid Cloning Name Description...Transfection Introduce plasmid DNA to mammalian cells Lentivirus Production Produce lentivirus with a ... virus from a preparation produced in mammalian cells Watch the Video! AAV Titration by qPCR Using SYBR...Transfection Introduce plasmid DNA to mammalian cells to produce antibodies Antibody Purification Purify...

...above the well. Very slowly and steadily, push the sample out and watch as the sample fills the well. After...perform gel electrophoresis. Equipment Casting tray Well combs Voltage source Gel box UV light source Microwave...the gel. Pour the agarose into a gel tray with the well comb in place. Pro-Tip Pour slowly to avoid bubbles...the gel. Any bubbles can be pushed away from the well comb or towards the sides/edges of the gel with ...sample causing it settle to the bottom of the gel well, instead of diffusing in the buffer. Once solidified...added EtBr to your gel, add some to the buffer as well. EtBr is positively charged and will run the opposite...of the gel. Note: When loading the sample in the well, maintain positive pressure on the sample to prevent...

...non-PCR–related fluorescence fluctuations and to minimize well-to-well variability that result from a variety of causes...mix into the wells. Reagent Amount for ONE Reaction Amount for 100 reactions (1 x 96 well plate) Universal...mix + water ). Add 15 μL of Master Mix per well and mix well by pipetting back and forth at least 5 times...by these institutions. This protocol is for a 96-well plate with 20 μL reaction volume. Last Update: February...buffer Nuclease-free water Microcentrifuge tubes 96-well optical plate Pipette tips General Considerations...pipetting error and variability Mix samples very well by pipetting back and forth multiple times at each...half of the final volume (mix with >50 uL if your well contains 100 uL) Use a multichannel pipette to load...

...use electro-competent cells instead of the more common chemically-competent cells. The number of bacterial...alone control will tell you your “background” level or more specifically it will tell you how many colonies...might need to express YGOI in cultured mammalian cells. The problem is that the only version of full-length...phosphatase treatment of your recipient plasmid as well as a specifically designed test digest later to ...the recipient plasmid DNA without any insert will tell you how much background you have of uncut or self-ligating... manufacturer’s instructions for your competent cells. For most standard cloning, you can transform 1-...1-2μl of your ligation reaction into competent cells such as DH5alpha or TOP10. If using much less total...

...use electro-competent cells instead of the more common chemically-competent cells. The number of bacterial...alone control will tell you your “background” level or more specifically it will tell you how many colonies...the recipient plasmid DNA without any insert will tell you how much background you have of uncut or self-ligating... manufacturer’s instructions for your competent cells. For most standard cloning, you can transform 1-...1-2μl of your ligation reaction into competent cells such as DH5alpha or TOP10. If using much less total...colonies, you might want to use higher competency cells. Additionally, if your final product is going to...

...12% NuPage Novex bis-tris mini gel, 1mm thick, 10-well, Invitrogen NP0321BOX 20X MOPS SDS running buffer...Carefully remove the comb from the gel. Rinse each well with 200 µL 1X MOPS running buffer. Fill the chamber...the prestained protein ladder to the appropriate well. Pro-Tip When possible, skip one lane before loading...each recombinant antibody sample to the appropriate well. Pro-Tip Leaving clear lanes between samples will...cast open. Use a razor blade to cut the top of the wells and bottom part of the gel where dye is visible....samples may not have been processed correctly in the cell (e.g., failure to cleave the signal peptide) and...Scatter chart. Change the data range and select the cells where the x-axis is represented. Add a linear trendline...

...investigator to conveniently plate and select transformed cells containing plasmids differing in their resistance... the plasmids of interest (for example, fewer satellite colonies will grow). It is, however, more expensive...bent to create an “L” shape, and then used like a cell spreader. Several other devices may be used for.... During the incubation, transform DH5α E. coli cells by heatshock with the plasmid of interest. See our...the liquid is mostly absorbed. The spreading of cells can be done in the same way as the antibiotic, using... using either a bent micropipette tip or other cell spreading device that fits the plate. Incubate plates...

...how to affinity purify recombinant antibodies from cell culture supernatant using Protein A or Protein G...250 mg benzamidine 25 mL of 2 mg/mL aprotinin Mix well and sterilize through a 0.2 µm PES filter. Aliquot...buffer to 1 part tissue culture supernatant and mix well. Uncap the Protein G Gravitrap or rProtein A Gravitrap...after use. Carefully pour the filtered and diluted cell culture supernatant into the Gravitrap column. Collect...

...bacterial cell. Large plasmids usually have a low copy number (approximately one or two copies per cell) and... can be present in large numbers, 50 or more per cell and have a high copy number. High copy number plasmids...increase this to 350 - 400 rpm to obtain a higher cell density. Reference Page Top Index...

... CRISPR Generate genomic deletions in mammalian cells lines using CRISPR/Cas9 Genomic Deletions with CRISPR... virus from a preparation produced in mammalian cells AAV Purification by Iodixanol Gradient Ultracentrifugation... the lab. Blog post: 10 Basic tips for mammalian cell culture Aseptic Technique Aseptic technique is a...fields such as microbiology, molecular biology or cell biology. Learn some of the key strategies of aseptic...

...dislodge any pellets or re-mix liquids. In cases where you are separating solids from a liquid, pellets represent...pointing up or out of the centrifuge so that the pellets form in approximately the same place in each sample...your experiment, you may be required to save the pellet, the supernatant, or both. Conclusion Centrifuges...