...sensitivity, wide dynamic range, and resistance to photobleaching has made luciferase a common choice in assays...optimized ( CBR2opt ) for mammalian expression systems. Each type of luciferase has advantages and disadvantages...luciferase desined de novo using deep-learning approaches. Split-Luciferase and Protein-Protein Interaction... using Gateway cloning. Use with 174051 Alberto Macho 174051 pGWB-cLUC Firefly Creation of C-terminal ... using Gateway cloning. Use with 174050 Alberto Macho 136010 psi-CHECK3 Firefly/Renilla Insertion of 3...

...using standard methods that have been optimized for each specific virus in order to generate high quality...obtained using ddPCR are generally higher than those achieved using the standard qPCR method. Quality Control...The specific QC experiments performed varies for each viral lot. To learn which specific QC experiments...Lentiviral vectors are titered using a ddPCR-based approach to quantify integrated copies of RRE. Briefly,...

..., TK25 FGFR3 fibroblast growth factor receptor 3 ACH, CD333, CEK2, HSFGFR3EX, JTK4 FGFR4 fibroblast growth...table for each category. The gene names in these tables link to the available plasmids for each gene. Please...STC-2, STCRP TAC1 tachykinin, precursor 1 Hs.2563, NK2, NKNA, NPK, TAC2 TACR1 tachykinin receptor 1 NK1R...organisms are exposed to millions of potential pathogens each day. Their ability to protect against infection ...enable cells of the immune system to communicate with each other across long distances. During infection and... these tables link to the available plasmids for each gene. Please note that not all genes have plasmids...PIG4, SAA, TP53I4 SAA2 serum amyloid A2 - SBDS Shwachman-Bodian-Diamond syndrome CGI-97, FLJ10917, SDS,...

...Cas9 nuclease form a complex with each individual, unique crRNA. (4) Each crRNA:tracrRNA:Cas9 complex seeks...Doyon Y. 2015. A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells...722-36. PMID: 26411297 Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM. ...

...for surface proteins and use enzymatic binding to attach substrate Control plasmids with a recognizable ...expressed and purified as described previously in Stachelhaus et al. 1998 References George N, Pick H, Vogel...J Am Chem Soc. 126(29):8896-7. PMID:15264811 Stachelhaus T, Mootz HD, Bergendahl V, Marahiel MA.1998. ...

...multiple isoforms or subunits, individual links to each gene page are provided below. Color is used for ...multiple isoforms or subunits, individual links to each gene page are provided below. Symbol Name 14-3-3...early ageing-associated phenotypes. Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann ...

...amino acid repeats. These repeats only differ from each other by two amino acids, their repeat-variable ... still determining the importance of context for each TAL effector within an array, but early studies ...Addgene’s history. Dr. Keith Joung’s lab at Massachusetts General Hospital also recently released a TALEN...

...present for a viral particle or virion to be produced. Each of these plasmids, however, retains the properties... of viruses that are commonly used for research, each of which exhibit different properties, and thus,...detailed information can be found in the guides for each virus type, linked above. Virus Expression Genome...

...titers are listed on each item's material page. Actual titers are reported with each shipment. Ginkgo Bioworks...the plasmid has been described previously we will reach out to the lab to ask them to deposit the plasmid...

...body during development. Unlike other cell types, each stem cell has the potential to either remain a stem...use. Since 2006, scientists have developed many approaches to generate iPSCs. The generation of iPSCs is...Xeno-Free Culture Conditions: A Clinically Compliant Approach. Stem Cells Transl Med. 2015 Mar 5. pii: sctm.2014...

...expression levels. This collection comprises 20 plasmids, each carrying two CRISPR guides. The first one binds ...integration of the aTc-inducible pTet-dCas9 in the attachment site of the phage 186. Detailed information about...

...mutant, knockdown, and overexpression constructs. Each collection page listed below organizes the plasmids...extremely important for classification and treatment. On each pathway page, click on a component to find plasmids...

... pooled collection, can be purchased at Addgene. Each transcription factor isoform has a unique 24 bp ... human transcription factor open reading frames. Each isoform is uniquely barcoded with a 24 bp sequence...

...titers are listed on each item's material page. Actual titers are reported with each shipment. For more ...

...AAAGGTCGAGAAACTGCAAA 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut...TGAAGAAAGTTATACTCGA 66099 cut S. pyogenes 25249454 Seydoux T (BRACHYURY) H. sapiens CACGCGCAGTTCGCGCTCTG 59726 cut S. ...GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes 26472758 Sabatini BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation...

...single round of viral entry and infection. This approach allows researchers to safely study mechanisms ...SARS-CoV-2 Spike protein and you will find examples of each in Addgene's collection: HIV-based lentiviral particles...

...consist of thousands of plasmids, each containing multiple gRNAs for each target gene. In a CRISPR screening...and target species. Additional information about each library can be found on the individual library page...

... Editing in Caenorhabditis elegans. A modified approach has also been developed by the Fire laboratory...Other Resources Addgene Blog Posts An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency Fluorescent...

...titers are listed on each item's material page. Actual titers are reported with each shipment. For more ...

...lab at the University of Florida. References for each serotype can be found below under Citations. AAV2...Plasmid Information The plasmid below is available in each of the above serotypes and buffers. Please click...