Skip to main content
Addgene

We narrowed to 57 results for: gfp gene

Showing: 1 - 40 of 57 results
  1. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... Gerlich 25999 LV-GFP Chromatin H2B GFP Elaine Fuchs 11680 H2B-GFP Chromatin H2B GFP Geoff Wahl 21210 ...61803 GFP-Rab7A Late endosomes Rab7a AcGFP Gia Voeltz 12605 GFP-rab7 WT Late endosomes RAB7 GFP Richard...Targeting Gene/Signal Fluorescent Protein PI 110060 FUW mCherry-GFP-LC3 Autophagosome LC3 mCherry, GFP Anne...Gadella 50057 pLYS1-FLAG-MitoGFP-HA Mitochondria MCU GFP Vamsi Mootha 49153 GFP-Mff Mitochondria-Outer ...Targeting Gene/Signal Fluorescent Protein PI 26722 GFP-cortactin Actin Filaments Cortactin EGFP Anna Huttenlocher...89472 GFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 GFP Ken-Ichi Takemaru 89770 pLenti-EGFP-hChibby1...Filaments beta-actin EGFP Robert Singer 27382 pDEST/N1-hEB1-GFP Microtubules EB1 GFP Robin Shaw 40908 pDEST...
  2. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...
  3. Adenovirus Plasmids

    Type
    Collection
    ... in E3 and insertion of GFP expression cassette. Bunz 179202 pAd5-B6/7 ∆E3-GFP Adenoviral A block for ...regions present in pAd5-B6 ∆E3-GFP and pAd5-B7 . Bunz 179203 pAd5-B1-deltaE1-GFP Adenoviral A block for the...containing transgene under CMV promoter Vogelstein 16404 pAdTrack Shuttle For production of GFP-trackable...containing transgene under a chosen promoter Vogelstein 16405 pAdTrack-CMV Shuttle For production of GFP-trackable...GFP-trackable viruses containing transgene under CMV promoter Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test...adenoviral plasmids. Want an adenoviral plasmid with your gene of interest? Search our database for adenoviral ...with large inserts Vogelstein 179201 pAd5-B6 ∆E3-GFP Adenoviral A block for the AdenoBuilder genome assembly...
  4. Optogenetics AAV Preps

    Type
    Collection
    ...soCoChR-GFP Syn CoChR (soma-targeted) GFP Constitutive 9 Boyden 107712 pAAV-hSynapsin-FLEX-soCoChR-GFP Syn...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Jaws GFP Constitutive 5, 8, rg* Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG...* Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn ChR2/H134R GFP Constitutive 8, rg* Boyden 100054 pAAV....Deisseroth 122063 pAAV-EF1α1.1-ChrimsonR-GFP EF1a ChrimsonR GFP Constitutive 2 Boyden 124650 pAAV-CamKIIa-C1V1...Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Boyden 59171 pAAV-...Constitutive 8 Deisseroth 22222 AAV-FLEX-Arch-GFP CAG Arch GFP Cre dependent 1, 9 Boyden 28305 pAAV-FLEX-...dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CaMKII ArchT GFP Constitutive 1, 5, 9, rg* Boyden 137148...
  5. Retrovirus Plasmids

    Type
    Collection
    ...MSCV-IRES-GFP MSCV For transgene expression and GFP marker Reya 21654 pMSCV PIG (Puro IRES GFP empty plasmid...Weinberg 10676 pMKO.1 GFP MoMLV U6-driven plasmid for shRNA expression; also expresses GFP. See pMKO.1 puro.... Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in mammalian...) MSCV For cloning and gene expression; select with puromycin or screen for GFP Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE...your gene fused to eGFP expression Clevers 18760 MSCV IRES Luciferase MSCV Plasmid for transgene expression...Lowe 9044 pMIG MSCV Plasmid for transgene expression; also expresses GFP. Also see pMIG-w , a variant that...transfer plasmids. Want a retroviral plasmid with your gene of interest? Search our database for retroviral ...
  6. Brain Initiative Collection

    Type
    Collection
    ...Fishell 83895-AAV1 pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP expression in forebrain GABA-...Fishell 83895-AAV2 pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP expression in forebrain GABA-...Fishell 83895-AAV8 pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP expression in forebrain GABA-...Fishell 83895-AAV9 pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP expression in forebrain GABA-...Fishell 83895-AAVrg pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP expression in forebrain GABA-...element Gordon Fishell 83900-AAV1 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV2 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...
  7. Caltech Systemic Capsids

    Type
    Collection
    ...Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element GFP, membrane-targeted GFP Control Dimidschstein ...pAAV-CAG-GFP CAG GFP Control Boyden 50465 pAAV-hSyn-EGFP hSyn EGFP Control Roth 50469 pAAV-CaMKIIa-EGFP CamKIIa...104061 CAG-NLS-GFP CAG NLS-GFP Control Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Control Wilson...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2 These viral vector preparations...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B10 These viral vector preparations...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B22 These viral vector preparations...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden AAV9-X1.1 These viral vector preparations...
  8. Fluorescent Protein Guide: Activity Regulation

    Type
    Collection
    ...Protein Purpose Principal Investigator Plasmids GFP GFP-dependent transcription factors Connie Cepko See...localization Biosensors Optogenetics Background Fluorescent proteins such as GFP have long been used for...scaffold to allow scientists to selectively modulate gene expression. Plasmid...regulate a variety of other activities. By using GFP as a scaffold, scientists can design de novo systems...modular components or take advantage of existing GFP-lines for cell-specific manipulation. Plasmids Fluorescent...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...
  9. Control AAV Preps

    Type
    Collection
    ...CAG-NLS-GFP CAG NLS-GFP Constitutive PHPeB Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Constitutive...Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 6, 8, 9, 11, rg*, PHPeB...*, PHP.eB, PHP.S Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB ...dependent PHP.V1 Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Fishell 83894... 5, 8, 9, rg* Deisseroth 122100 pAAV-EF1α1.1-GFP EF1a GFP Constitutive 2 Boyden 128434 pAAV-Ef1a-fDIO-...PHP.eB Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory EGFP Constitutive 1, 9, PHP.eB Dimidschstein... 9 Wilson 105598 pAAV.GfaABC1D.PI.Lck-GFP.SV40 GfaABC1D Lck-GFP Constitutive 5 Khakh 105622 pAAV.CamKII...
  10. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...genome MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene expression with GFP or mCherry selectable...expression vector GFP Varies pMKO.1 GFP - Retroviral shRNA expression pLenti CMV GFP DEST - ...Fluorescent proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression...host genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for gene expression pLenti CMV/... vector for gene expression pINDUCER21 (ORF-EG) - Inducible lentiviral gene expression ...destination vector for gene expression Lentiviral backbones made by Addgene Addgene has an extensive collection...one sgRNA pMKO.1 GFP - Retroviral shRNA expression Retroviral backbones made by Addgene Adenoviral High...
  11. Retrograde AAV viral preps

    Type
    Collection
    ... pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Control Fishell... PI 37825 AAV-CAG-GFP CAG GFP Control Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent Control...Jaws-KGC-GFP-ER2] CAG Inhibitor, Cre-dependent Optogenetics Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527)...Flp-dependent Optogenetics Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn Activator Optogenetics Boyden 59170... Activator Optogenetics Fishell 65014 pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Inhibitor Optogenetics Boyden 84445...Recombinases Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP-tagged Cre expression Recombinases...59170 pAAV-Syn-Chronos-GFP Syn Activator Optogenetics Boyden 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 mDIx...
  12. Brain Armamentarium

    Type
    Collection
    ...James M. Wilson 37825-CAP-B10 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana...Viviana Gradinaru 37825-CAP-B22 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana... Gradinaru 37825-CAP-MaCPNS1 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana... Gradinaru 37825-CAP-MaCPNS2 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana...pAAV-AiE0873m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN5140) Expression of CoChR-EGFP in striatal cholinergic...pAAV-AiE0452h_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4035) Expression of CoChR-EGFP in striatal indirect pathway...pAAV-AiE0779m_3xC2-minBG-CoChR-EGFP-WPRE3-BGHpA (Alias: CN4033) Expression of CoChR-EGFP in striatal direct pathway...
  13. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ... numerous GFP-variants and non-GFP proteins that result in a diverse set of colors. Addgene has assembled...Expression pRSETA-PAGFP - Bacterial Expression tandem PA-GFP-KanR - Yeast Expression pFA6a-PA-GFP-kanMX6 - Yeast...Expression pFA6a-link-yEPAGFP-CaUra3 - Yeast Expression mPA-GFP-N1 - Mammalian Expression mPA-GFP-C1 - Mammalian... green fluorescent protein (GFP) was cloned in 1992 ( Prasher et al., Gene, 1992 ), and since then scientists...tagging with mCherry, mOrange, mCerulean pET GFP - C-terminal GFP for bacterial expression Davidson Lab Plasmids...Expression EGFP 488 507 34 6 Prone to dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian...Mammalian Expression PA-GFP 504 517 14 Monomer (A206K) pPAGFP-N1 - Mammalian Expression pPAGFP-C1 - Mammalian ...
  14. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics Ed Boyden AV-1-PV3446 59170-AAV1 pAAV-Syn-Chronos-GFP Optogenetics Ed Boyden...pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics Ed Boyden AV-5-PV3446 59170-AAV5 pAAV-Syn-Chronos-GFP Optogenetics Ed Boyden...AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-9-PV2527 99039-AAV9 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics Ed Boyden...29777-AAV5 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV2509 29777-AAV9 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV3446 59170...D156A)-EYFP Optogenetics Karl Deisseroth AV-1-PV2432 22222-AAV1 AAV-FLEX-Arch-GFP Optogenetics Ed Boyden...pAAV-Syn-ChrimsonR-tdT Optogenetics Ed Boyden AV-5-PV3638 65014-AAV5 pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics Ed Boyden...pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics Ed Boyden AV-9-20071P 20071-AAV9 pACAGW-ChR2-Venus-AAV Optogenetics Karel ...
  15. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...68299 GFP E17TAG/Q157TAG Plasmid 68298 GFP S2TAG/E17TAG Plasmid 68297 GFP Q157TAG Plasmid 68296 GFP S2TAG...for the incorporation of phosphoserine into your gene of interest. Depositor...Library 111704 Mode #1 Library Plasmid 69118 E17TAG GFP zeo resistance Plasmid 68307 SupD Strain 68306 C321...S2TAG Plasmid 68295 GFP E17TAG Plasmid 68294 SepOTSν Plasmid 68292 SepOTSλ Plasmid 68291 SepOTSκ Plasmid...phosphoserine into the growing polypeptide chain to generate the new phosphorylated protein. Protein Phosphorylation...by adding this phosphorylated amino acid to the genetic code of E. coli (Park et al., 2011). Follow up ...further details in Mohler et al. (2023) and find general tips on phosphoprotein expression in rEcoli XpS...
  16. Viral Production

    Type
    Collection
    ... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, or both...Karl Deisseroth (Addgene viral prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from... plasmid encoding Rep and serotype-specific Cap genes, and a plasmid encoding adenoviral helper sequences...viral vectors are tested in vitro and in vivo for gene expression and/or function. These data are sometimes...copies of the lentiviral Rev responsive element (RRE) gene and the cellular ribonuclease P/MRP 30 kDa subunit...Production AAV distributed by Addgene has been produced either in-house by Addgene scientists or through collaboration...
  17. AAV Molecular Tools

    Type
    Collection
    ...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...System Activity Serotype PI 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-...Long Overexpression Tools These AAV encode various genes for overexpression. ID Name Expression System Activity... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...and synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...Ready-to-use AAV available from Addgene's viral service encoding tet-off transactivators and tools for...
  18. Lentiviral Prep Service

    Type
    Collection
    ...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...Screening Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more... Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled libraries...library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...SpCas9. 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin...library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...
  19. Validated gRNA Sequences

    Type
    Collection
    ...23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981...cut S. pyogenes 26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130...26018130 Xue inverted GFP A. victoria GTTGATCCATAACTTCGTAT 66584 cut S. pyogenes 26018130 Xue IRF1 H. sapiens...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...
  20. Zhang Lab CRISPR Page

    Type
    Collection
    ...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion ... information, please visit the Addgene SAM library page . Targeted gene activation using SAM There are...available for mammalian endogenous gene activation using SAM: Addgene plasmids #61422 - #61424 were designed...contain a combination of CRISPR-associated (Cas) genes as well as non-coding RNA elements capable of programming...for the transcriptional activation of endogenous genes. It consists of three components: A nucleolytically...human codon-optimized, and packages both the SaCas9 gene and its single guide RNA (sgRNA) into one plasmid...
  21. Serotype Testing AAV

    Type
    Collection
    ...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information...Ready-to-use AAV available from Addgene's viral service. Control EGFP vectors in various serotypes for... 37825-AAVrg.T 20 µL $ 150 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...
  22. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...199419 Anti-GFP [N86/38R-2b] GFP Aequorea victoria Mouse IgG2b 199420 Anti-GFP [N86/8R-2b] GFP Aequorea ...206719 Anti-GFP [N86/38R-1] GFP Aequorea victoria Mouse IgG2a 206720 Anti-GFP [N86/8R-1] GFP Aequorea victoria...Rat Mouse 206743 GFP scFv [N86/44] N86/44 scFv GFP Aequorea victoria Mouse 206744 GFP scFv [N86/20] N86...short and long Rat Mouse IgG2a 114492 Anti-GFP [N86/38.1R] GFP Aequorea victoria Mouse IgG2a 114493 Anti-NGL...glutamate receptor Rat Mouse IgG2a 177572 Anti-GFP [N86/8R] GFP Aequorea victoria Mouse IgG2a 177573 Anti-...N479/107R] VAPA/B Mouse IgG2a 188164 Anti-GFP [N86/44R] GFP Aequorea victoria Mouse IgG2a 188165 Anti-.../22R] Prrt2 Mouse Mouse IgG2a 188166 Anti-GFP [N86/20R] GFP Aequorea victoria Mouse IgG2a 188167 Anti-...
  23. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...comprehensive comparison to GFP, please refer to NEB's comparison of SNAP-tag, CLIP-tag, and GFP . Technology SNAP-tag...England Biolabs has deposited plasmids at Addgene to generate SNAP, CLIP, ACP or MCP tagged plasmids for...associated with this technology are available at Addgene for distribution to the research community. Key...synthases needed for use of these tags. Plasmids Addgene ID Plasmid Substrate Feature 101137 pSNAP-tag (...and the ACP and SFP Synthases. Users may still generate their own fluorescent or non-fluorescent CoA substrates...
  24. Chemogenetics AAV Preps

    Type
    Collection
    ... 52536 rAAV-CAG::FLEX-rev:: hM4D-2a-GFP hM4D(Gi) - Inhibition GFP Cre-dependent 1 Sternson 154867 pAAV-hSyn-fDIO-hM4D...Service AAV Chemogenetics Viral Vector Packaging Service: Chemogenetics AAV Use our chemogenetics AAV to chemically...IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP none 5 Sternson 119744 AAV CAMKII PSAM4 GlyR IRES EGFP PSAM4...Ready-to-use AAV available from Addgene's viral service encoding chemogenetics tools. Viral...in specific cell types. See our Chemogenetics Plasmids and Chemogenetics Guide pages for more information...119741 AAV SYN flex PSAM4 GlyR IRES EGFP PSAM4 GlyR - Inhibition IRES EGFP Cre-dependent 5, 9 Sternson 119742... Fusion tags mCherry HA Non-fusion tags mCitrine EGFP dTomato Activity Cre-dependent Flp-dependent Cre...
  25. Tetracycline Inducible Expression

    Type
    Collection
    ...promoter upstream of your gene of interest. If your gene of interest should be generally active and only turned...Iwasato 63704 pRetroX GFP T2A Cre Retroviral vector for dox-inducible expression of GFP T2A Cre recombinase...Tet-On Systems for Doxycycline-inducible Gene Expression . Curr Gene Ther, 16 (3), 156–167. https://doi.org...Tet-On system for regulated gene expression through viral evolution . Gene Ther, 13 (19), 1382–1390. https...downstream gene via its activation domain than simply removing the repressor. 2nd and 3rd Generation Systems...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS...
  26. Bacterial Expression Systems

    Type
    Collection
    ...knocking out genes or introducing specific mutations can reveal important insights into gene function. These...Vladislav Verkhusha 52732 52733 pET11a-link-NGFP pMRBAD-link-CGFP GFP (reconstructed) BiFC Lynne Regan 168257... mammalian cells. Addgene Blog A Guide to Selecting Fluorescent Dyes and Ligands GFP Fusion Proteins —...expression of a gene of interest in E. coli . The Marionette Sensor Collection (Addgene #1000000137) allows...of up to twelve genes using small-molecule inducers in the same E. coli strain. Addgene Blog Inducible ...Fluorescence (GFP+) Gram-negative bacteria Philip Poole 14460 pOT2 Promoter activity Fluorescence (GFPuv) Gram-negative...bacterial gene biology or engineering metabolic pathways to synthesize a target metabolite, genetic tools ...
  27. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...fluorescent biosensors to measure biomolecules or genes via FRET or other assays. Plasmid...specific biomolecules, the activity of specific genes and cellular processes, or other factors like environmental...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP...
  28. Genetic Code Expansion

    Type
    Collection
    ...express first with a control reporter geneGFP for E. coli or mCherry-GFP for mammalian cells. You should ...EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR). ...EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tolC, and tyrU gene replaced by GentR) and...Removed endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV gene replaced by tRNA variant that suppress...endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA variant that suppress...endogenous EcTyrRS/tRNA pair (tyrS gene knocked out, tyrTV and tyrU genes replaced by tRNA variant inactivated...that contain genes with modified codons for unnatural amino acid incorporation. ID Plasmid Gene/Insert Vector...
  29. Luciferase Plasmid Collection

    Type
    Collection
    ...Explore Addgene's collection of luciferase plasmids for gene expression assays and bioluminescent reporters...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...luciferase-containing plasmid and the effects on gene expression can be measured by the luminescence output...into which you can clone your regulatory element or gene of interest into to create a luciferase reporter...Firefly, Renilla Creating ORF-Firefly luciferase gene fusions. Renilla luciferase under the control of...enhancer regions. Mutations within the luciferase gene allow for increased copy number in E. coli and expression... Retroviral expression of firefly luciferase and gene of interest Scott Lowe 21375 pHIV-Luciferase Firefly...
  30. Lentivirus Plasmids

    Type
    Collection
    ...viral particle) and toxicity of the gene product (i.e., if the gene encoded by the transfer plasmid is ...hUbC-driven EGFP; can be used for cDNA expression Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA ...promoter for transgene and CMV drives expression of RFP as a reporter. See plasmid 17618 for GFP plasmid. ...24129 pULTRA 3rd bi-cistronic expression of EGFP and the gene of interest, also can express shRNA (cloning... which can be modified to encode a wide range of gene products. The main restrictions on a lentiviral ...chimeric 5’LTR, Any expression cassette (promoter and gene of interest) can be cloned into the plasmid. Nolan...gateway plasmid, constitutive Hygromycin resistance gene coexpression. See article for other versions of ...
  31. Feng Zhang Multiplexed Overexpression of Regulatory Factors (MORF) Collection

    Type
    Collection
    ...transcription factor collection that contains 1,836 genes encoded by 3,548 isoforms and two control vectors...10X scRNA-seq (PDF, 59.2 KB) Plasmids ID Plasmid Gene/Insert Pooled Library The MORF pooled library is...transcription factor open reading frames with or without GFP and mCherry controls. Do you have suggestions for... transcription factor collection, available at Addgene. The collection can be used for screening transcription... entire pooled collection, can be purchased at Addgene. Each transcription factor isoform has a unique...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...
  32. CRISPR Plasmids for Genomic Visualization

    Type
    Collection
    ... Cas9 (dCas9) fused to a fluorescent marker like GFP, researchers have turned dCas9 into a customizable... throughout the chromosome. Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication...Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing Other...out our Suggest a Plasmid form or e-mail help@addgene.org to help us improve this resource!...
  33. CRISPR Plasmids - Tagging

    Type
    Collection
    ...listed below. When targeting other gene loci, you will prepare the gene-specific CRISPR and donor vectors...FLP expression vectors, a general cloning plasmid, and a prebuilt Unc-32::GFP targeting vector. Jorgensen...multiple genes. Plasmids can be found associated with the following article: Paix, et al. Genetics 2014 Allen...CRISPR plasmids for endogenous tagging of your gene of interest. CRISPR...repair template design. How to use CRISPR to tag your gene of interest Mendenhall and Myers Tagging System ... the plasmids as listed in each row. If your own gene of interest is currently unavailable, you will need...terminal affinity tag (3xFLAG-2xSTREP) on endogenous genes for the isolation of native protein complexes. This...
  34. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...possible deletion strategies for genes and non-coding elements. For creating a gene knockout, two sgRNA located...evaluate the RNA, perform RT-qPCR for gene expression of the relevant gene 7,8 . To evaluate the protein, perform...genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple... as pX458 (Addgene plasmid ID 48138) or pX459 (Addgene plasmid ID 48139), which include GFP and puromycin...for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines. Protocol...CRISPR/Cas9 construct (10 μg total). Add 0.5 μg of GFP expression construct. Electroporate cells with 250...filter into a FACS tube. FACS sort the top ~3% of GFP positive cells in order to enrich for cells that ...
  35. Bikard Lab - CRISPR Repression Collection

    Type
    Collection
    ...reporters simultaneously. By fusing sfGFP and/or mCherry to genes of interest, it is thus possible to ...to bind on the chromosome. When dCas9 binds to a gene, it blocks the progression of the RNA polymerase...enables robust, noiseless knockdown of bacterial genes. Molecular Systems Biology, 14(3):e7899. doi: 10.15252... CRISPR knockdown to modulate expression of two genes without cross‐talk. (A) Schematic of the strain ... the tracrRNA sequence (not shown). (B) Relative GFP and RFP concentration given relatively to the non‐targeting...carrying two CRISPR guides. The first one binds to sfgfp with either 0, 10, 11, 14, or 20 matching nucleotides...sites. The levels of the two reporters, mCherry and sfgfp in this case, can be controlled using a plasmid‐...
  36. All Antibodies

    Type
    Collection
    ...popular markers like tubulin or epitope tags like Myc, GFP, and more. Neuroscience : Antibodies targeting proteins...Browse Addgene's collection of recombinant monoclonal antibodies. Antibodies...Antibodies Addgene distributes ready-to-use recombinant antibodies. These monoclonal antibodies undergo application-specific...application-specific validation and quality control by Addgene as well as by our trusted partner labs. On this...antibodies currently available from our catalog. Addgene values transparency and accessibility in research...reactivity. Reactivity is based on validation data from Addgene or trusted partner labs or is predicted based on... on sequence homology with the antigen. Addgene supplies a list of recommended applications based on our...
  37. CRISPR References and Information

    Type
    Collection
    ...vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2) , human CD2 (...identify positively or negatively selected sgRNAs, genes, or pathways. For use with genome-scale CRISPR-Cas9...CRISPR screens targeting a long or short list of genes provided by the user. Developed by the Fredrik Wermeling...sgRNA design tool for genome editing, as well as gene regulation (repression and activation). Genome support...target sites by off-target quality. Validated for gene inactivation, NHEJ, and HDR. Includes a wide range... to identify novel gRNA target sites in a single gene, as well as a target site common to a set of similar... Information Addgene Resources CRISPR Software General Resources CRISPR Protocols Addgene CRISPR Resources...
  38. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ... pCAG-SpCas9-GFP-U6-gRNA 79144 Mammalian hU6 yes, cut S. pyogenes EGFP Zou pCAG-eCas9-GFP-U6-gRNA 79145...Church LRG (Lenti_sgRNA_EFS_GFP) 65656 Mammalian/Lentiviral LIC none S. pyogenes GFP Vakoc U6>sgRNA(F+E) 59986...cut Lb Cpf1 Neo Welker AIO-GFP 74119 Mammalian U6x2 yes, nick S. pyogenes EGFP Jackson AIO-mCherry 74120...are expressed as polycistronic glycine tRNA-gRNA genes (PTGs) and then PTG cassettes are assembled into...capable of simultaneously repressing multiple target genes in Escherichia coli. Koffas Do you have suggestions...none S. pyogenes Zhang pL-CRISPR.EFS.GFP 57818 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert...none S. pyogenes Zhang pLKO5.sgRNA.EFS.GFP 57822 Mammalian/Lentiviral BsmBI none S. pyogenes EGFP Ebert ...
  39. Recombinases AAV Preps

    Type
    Collection
    .../Tag Serotype(s) PI 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP 9, rg* Wilson 105558 pENN.AAV.CamKII...site-specific recombinases, which can be used to control gene expression. See our Cre-lox Plasmids page for more...2, 5, 8, 9, rh10 Wilson 105545 pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 CMV eGFP 1, 2, 5, 8, 9 Wilson 55632 pAAV-Ef1a-mCherry-IRES-Cre...EBFP-Cre Syn EBFP 5 Zeng 105540 pENN.AAV.hSyn.HI.eGFP-Cre.WPRE.SV40 Syn eGFP 1, 2, 5, 8, 9, rg*, PHPeB Wilson...
  40. Antibody Plasmid Collection

    Type
    Collection
    ...find antibody plasmids for: Common antigens such as GFP or mCherry Monoclonals, Nanobodies, Sybodies, or ...-mouse" or "anti-rabbit") ID Plasmid Description Gene/Insert PI Return to top Do you have suggestions ...Find information on Addgene's collection of plasmid-based antibodies, including monoclonal antibodies...Plasmid Collection Antibody Plasmid Collection Addgene distributes ready-to-use recombinant antibodies...application-specific validation and quality control by Addgene as well as by our trusted partner labs. Learn More...animals or hybridoma cells, but are difficult to generate due to expense and time. An alternative approach...peptide, from the popular SunTag system, fused to sfGFP for imaging. Learn more about antibodies and their...
Showing: 1 - 40 of 57 results