We narrowed to 25 results for: ALP
-
TypeCollection...MGC126714, MIP-4a, MIP-4alpha, SCYA26, TSC-1 CCL27 chemokine (C-C motif) ligand 27 ALP, CTACK, CTAK, ESKINE...interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha 14 LEIF2H...interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha 2 IFNA, INFA2...IFNA5 interferon, alpha 5 INFA5 IFNA6 interferon, alpha 6 - IFNA7 interferon, alpha 7 IFNA-J IFNA8 interferon...activator subunit 1 (PA28 alpha) IFI5111, MGC8628, PA28A, PA28alpha, REGalpha PSME1 proteasome (prosome...activator subunit 1 (PA28 alpha) IFI5111, MGC8628, PA28A, PA28alpha, REGalpha PSME2 proteasome (prosome...
-
Trimmer Lab NeuroMab Collection
TypeCollection...-GABA(A)R, Alpha4 [N398A/34R] GABA(A)R, Alpha4 Rat Mouse IgG2a 177544 Anti-GABA(A)R, Alpha2 [N399/19R]...GABA(A)R, Alpha4 scFv [N398A/34] N398A/34 scFv GABA(A)R, Alpha4 Rat Mouse 190552 GABA(A)R, Alpha2 scFv [N399...Mouse IgG2a 128634 Anti-Slo1/BKAlpha maxi-K+ channel [L6/23R] Slo1/BKAlpha maxi-K+ channel Mouse Mouse ...Mouse IgG2a 149456 Anti-GABA(A)R, Alpha5 [N415/24R] GABA(A)R, Alpha5 Human Mouse IgG2a 149458 Anti-Cavbeta2...Mouse IgG2a 164155 Anti-GABA(A)R, alpha6 [N229A/32R] GABA(A)R, alpha6 Mouse Mouse IgG2a 164156 Anti-Gamma-protocadherin-C3...Mouse IgG2a 177486 Anti-Slo1/BKAlpha maxi-K+ channel [L6/60R] Slo1/BKAlpha maxi-K+ channel Mouse Mouse ...Mouse IgG2a 177574 Anti-GABA(A)R, Alpha1 [N95/35R] GABA(A)R, Alpha1 Human Mouse IgG2a 177575 Anti-Collybistin... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Microtubules alpha-tubulin mTurquoise2 Dorus Gadella 85045 pmScarlet_alphaTubulin_C1 Microtubules alpha-tubulin...Microtubules alpha-tubulin mCherry* Michael Davidson 12298 pIRESneo-EGFP-alpha Tubulin Microtubules alpha-tubulin...EGFP Anthony Brown 11908 pEGFP-N1 alpha-actinin 1 Actin Filaments alpha-actinin 1 EGFP Carol Otey 27676 ...mScarlet Dorus Gadella 85046 pmScarlet-H_alphaTubulin_C1 Microtubules alpha-tubulin mScarlet-H Dorus Gadella...Gadella 85047 pmScarlet-i_alphaTubulin_C1 Microtubules alpha-tubulin mScarlet-I Dorus Gadella 85054 pLifeAct_mScarlet_N1...mGold Francois St-Pierre 49149 mCh-alpha-tubulin Microtubules alpha-tubulin mCherry Gia Voeltz 89472 GFP-hChibby1...Beta-catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens Junctions E-cadherin EGFP Alpha Yap 71366... -
Cre-lox system
TypeCollection...11920 pBS500 EF1alpha-GFPcre Cre-GFP fusion EF-1 alpha Mammalian Sauer 11923 pBS598 EF1alpha-EGFPcre Cre-EGFP...fusion EF-1 alpha Mammalian Sauer 11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion EF-1 alpha Mammalian Sauer...Cre hCMV Mammalian Sauer 11918 pBS513 EF1alpha-cre Cre EF-1 alpha Mammalian Sauer 11919 pBS448 RSV-GFPcre...mCherry coexpression EF-1 alpha AAV Deisseroth 55635 pAAV-EF1a-sCre SCre EF-1 alpha AAV Deisseroth 55636 pAAV-EF1a-Cre...pAAV-EF1a-Cre Cre EF-1 alpha AAV Deisseroth 55638 pAAV-EF1a-vCre VCre EF-1 alpha AAV Deisseroth 59701 pRetroQ-Cre-ERT2...pDIRE iCre and FlpO, required for dual RMCE EF-1 alpha Mammalian Zeller 26850 pBF3038 Cre codon optimized... Cre-IRES-PuroR Cre and PuroR coexpression EF-1 alpha Lentiviral Kotton 30524 pCSHSP:Cre heat shock inducible... -
Neurodegeneration Plasmid Collection
TypeCollection..., V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's..., V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's..., V5 EF-1 alpha Parkinson's Mark Cookson 29398 pDEST51-LRRK2-R1398Q LRRK2 His, V5 EF-1 alpha Parkinson's..., V5 EF-1 alpha Parkinson's Mark Cookson 29400 pDEST51-LRRK2-T1343G LRRK2 His, V5 EF-1 alpha Parkinson's...30147 pCAX APPs-695-alpha APP CAG Alzheimer's Dennis Selkoe 30149 pCAX APPs-751-alpha APP CAG Alzheimer'...40822 EGFP-alphasynuclein-WT SNCA GFP CMV Parkinson's David Rubinsztein 40823 EGFP-alphasynuclein-A53T SNCA... pHM6-alphasynuclein-WT SNCA His, HA CMV Parkinson's David Rubinsztein 40825 pHM6-alphasynuclein-A53T ... -
Nuclear Receptor Signaling Atlas (NURSA) Plasmid Guide: Nuclear Receptors
TypeCollection...Plasmids ESRRA, ERR1, ERRa, ERRalpha, ESRL1, NR3B1 estrogen-related receptor alpha ESRRB Plasmids ESRRB, DFNB35... HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF14 hepatocyte nuclear factor 4, alpha NR0B1 Plasmids...5E3.5, NR1C1, PPAR, PPARalpha, hPPAR peroxisome proliferator-activated receptor alpha PPARD Plasmids PPARD...receptor, alpha RORA Plasmids RORA, ROR1, ROR2, ROR3, RZRA, NR1F1, MGC119326, MGC119329, RZR-ALPHA, DKFZp686M2414... RXRA Plasmids RXRA, NR2B1 retinoid X receptor, alpha RXRG Plasmids RXRG, NR2B3, RXRC retinoid X receptor... -
Lentivirus Plasmids
TypeCollection...cloned into the plasmid. Nolan 12257 pWPXL 2nd EF-1alpha driven constitutive transgene expression, contains...gives you high expression. Trono 12254 pWPI 2nd EF-1alpha driven constitutive transgene expression and EGFP...EGFP coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...similar plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin Microtubules 87422 LMNB1-mEGFP AICSDP-10...Peroxisomes 101785 TUBA1B-mTagRFP-T AICSDP-28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1-mEGFP AICSDP...Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T... -
Validated gRNA Sequences
TypeCollection...Moffat AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...Shaw AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens... -
MAPK Plasmids
TypeCollection...PRKM8, SAPK1, SAPK1c MAPK9 JNK-55, JNK2, JNK2A, JNK2ALPHA, JNK2B, JNK2BETA, PRKM9... PRKM15, RK, SAPK2A, p38, p38ALPHA MAPK15 ERK7, ERK8 *Image is licensed under the... -
Institute for Protein Innovation
TypeCollection... of mechanotransduction receptors, comprised of alpha-beta subunit heterodimers. The IPI collection contains...contains antibodies that uniquely: Bind to the alpha subunit, outside the ligand-binding pocket Bind to... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...13421 pAC-Kan-alphaGal4 13422 pBAC-lacZ 13424 KJBAC1 strain 21869 pKJ1267 (aka pAC-alphaGal4) 21870 pKJ1712... -
Synthetic Biology - Overview
TypeCollection...Blog Genome Engineering SynBio Depositing Labs Hal Alper J. Chris Anderson Adam Arkin Gabor Balazsi Matthew...Mammalian Worm Fungal Algal Featured SynBio Deposits Alper Lab Y. Lipolytica Promoters Anderson Lab Plasmids... -
Ras Pathway
TypeCollection... PPP1CA Protein phosphatase 1 catalytic subunit alpha PREX2 Phosphatidylinositol-3,4,5-trisphosphate-dependent... kinase AMP-activated: A1,A2: Catalytic subunit alpha B1,B2: non-catalytic subunit beta G1, G2, G3: non-catalytic... -
Brzezinski Lab CRISPR Collection
TypeCollection...modifications: replacement of the Cbh promoter with EF1alpha addition of an mCherry reporter variant nuclear... -
mTOR Pathway
TypeCollection...catalytic and regulatory subunits - Class I PKC PKC alpha PKC beta PKC delta PKC epsilon PKC gamma PKC eta... -
p53 Pathway
TypeCollection...GADD45G Growth arrest and DNA-damage-inducible; alpha, beta, or gamma IGF-BP3 Insulin-like growth factor... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...-shRNA3 72598 Expresses shRNA against mouse TNF-alpha mRNA from the mouse U6 promoter pCDH-EF1-Nluc-P2A-copGFP-T2A-Puro... -
Open Enzyme Collection
TypeCollection...Drosophila 165580 pOpen-BovDNTT Bovine DNTT 165555 pOpen-ALPI CIP (calf intestinal phosphatase) Return to top ... -
Neurodegeneration Research Collection
TypeCollection... and Noteworthy: Use a CRISPRi system to target alpha-synuclein. Sastre et al. Sci Rep. 2023 Oct 18. ...