Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 75 results
  1. Immunology Research Plasmids and Resources

    Type
    Collection
    ...IFNA10 interferon, alpha 10 MGC119878, MGC119879 IFNA13 interferon, alpha 13 - IFNA14 interferon, alpha...IFNA16 interferon, alpha 16 - IFNA17 interferon, alpha 17 IFNA, INFA, LEIF2C1 IFNA2 interferon, alpha ...MGC142200 IFNA5 interferon, alpha 5 INFA5 IFNA6 interferon, alpha 6 - IFNA7 interferon, alpha 7 IFNA-J IFNA8...
  2. Validated gRNA Sequences

    Type
    Collection
    ... 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic GACAGAACGATGCGCTGAAT 68898 interfere S. pyogenes... 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes...AAACAAAACCTCATCAGGCA 68900 interfere S. pyogenes 26918244 Lu PcfiA GAAGCTCACTCCTTAGCACG 68899 interfere S. pyogenes ...74066 interfere S. pyogenes 26829286 Lu pgi C. glutamicum TTGCCTGGAAGTTTGAGTAATGAT 74067 interfere S. pyogenes...74068 interfere S. pyogenes 26829286 Lu pck C. glutamicum TCCAGTTCAGCAGTTCCTTATTCT 74069 interfere S. pyogenes...74070 interfere S. pyogenes 26829286 Lu pyk C. glutamicum ATTCCATCTGCACTAGCCACCGCT 74072 interfere S. pyogenes.... thetaiotaomicron GAAAATGGGGTGTATCCTGC 68892 interfere S. pyogenes 26918244 Lu BT1854 B. thetaiotaomicron...
  3. Viral Production

    Type
    Collection
    ...protocols and performing rigorous quality control (QC). The specific QC experiments performed varies for ...Link opens in a new window) . Transfections are performed using the transfer plasmid, a plasmid encoding...and stored at -80 °C. Titer Titering is either performed by Addgene or by the University of Pennsylvania...Pennsylvania Vector Core. In general, titering is performed by the facility that produced the viral vector lot....Pennsylvania Vector Core is (as of April 2016) also performed by droplet digital PCR (ddPCR). Quality Control.... To learn which specific QC experiments were performed on your lot, please contact us . Full sequencing...the Viral Genome Next-generation sequencing is performed on viral genomes isolated from the final AAV preparation...
  4. Arf GTPase Family

    Type
    Collection
    ... Plasmid Collections ARF Superfamily Plasmids for ARF Superfamily Research You may also like... ...members of the RAS superfamily, though recently have been argued to form their own superfamily (Klinger, et ... GTPase signaling activity. Locations of ARF Superfamily members. Figure from Szutl, et al 2019 PMID: ...: 31084567 . More information about ARF Superfamily members can be found in: ARF GTPases and their GEFs... and challenges Sztul E, Chen PW, Casanova JE, Cherfils J, Dacks JB, Lambright DG, Lee FS, Randazzo PA...
  5. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...vector, but their function (cut, nick, activate, interfere, etc.) is limited to that of the Cas protein present...have plasmids with Cas9 that can cut, activate, interfere, or nick. Selection , such as Puromycin or EGFP...Joung pCRISPathBrick 65006 Bacteria BsaI yes, interfere S. pyogenes Koffas BPK764 65767 Bacteria BsaI ...pyogenes Joung MSP712 65768 Bacteria BsaI yes, interfere S. pyogenes Joung sgRNA with U6 promoter 48962...pyogenes Bar Chen pBUN6I11 50580 Plant BsaI yes, interfere S. pyogenes Bar Chen pBUN411 50581 Plant BsaI ...pyogenes Hyg Chen pHSN6I01 50587 Plant BsaI yes, interfere S. pyogenes Hyg Chen pHSN501 50589 Plant BsaI ...
  6. Mammalian RNAi Tools

    Type
    Collection
    ...Plasmids for mammalian RNA interference (RNAi) experiments at Addgene; browse by constitutive lentiviral...packaging and expression plasmids Background RNA interference (RNAi) is an RNA-mediated gene silencing mechanism...The dsRNA can be delivered as an siRNA (short interfering RNA) via transfection, or shRNA (short hairpin... 2006. Feb;3(2):109-16. PubMed . In vivo RNA interference demonstrates a role for Nramp1 in modifying ... Tuning silence: conditional systems for RNA interference. Wiznerowicz M, Szulc J, Trono D. Nat. Methods.... PubMed . Cre-lox-regulated conditional RNA interference from transgenes. Ventura A, Meissner A, Dillon...cells, stem cells and transgenic mice by RNA interference. Rubinson DA, Dillon CP, Kwiatkowski AV, Sievers...
  7. CRISPR Guide

    Type
    Collection
    ...Some Acr proteins interfere with DNA binding at the PAM site whereas others interfere with the Cas9 HNH...within the genome. In a perfect world, your gRNA target sequence would have perfect homology to your target...editing technologies. This advantage makes CRISPR perfect for genome-wide screens. This guide will provide.... Ideally, a gRNA targeting sequence will have perfect homology to the target DNA with no homology elsewhere...in robust transcriptional repression (CRISPR interference, or CRISPRi ) or activation ( CRISPRa ) of downstream...chromosome. Browse Plasmids: Activate , Repress/Interfere Epigenetic Modifications Using CRISPR Inactive...Your CRISPR Experiment Get Started CRISPR is a powerful system that enables researchers to manipulate ...
  8. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...colonies and inoculate into a mini-prep culture. Perform mini-prep for each sample and sequence each colony...may be scaled based on the required DNA yield. Perform maxi-prep for each CRISPR/Cas9 construct. Transfecting... cell type used at limiting dilution prior to performing this step to reliably obtain approximately 30...genomic DNA isolation may be utilized to be able to perform PCR in step 6.3 . Assemble a 20 μl PCR with the...reproducibility of results. To evaluate the RNA, perform RT-qPCR for gene expression of the relevant gene...gene 7,8 . To evaluate the protein, perform an immunoblot using an antibody against the relevant protein...
  9. CRISPR Plasmids - Plants

    Type
    Collection
    ...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a ...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target... S. pyogenes Bar Chen pBUN6I11 OsU3 BsaI yes, interfere S. pyogenes Bar Chen pBUN501 AtU6-26 BsaI yes,... pyogenes Hyg Chen pHSN6I01 AtU6-26 BsaI yes, interfere S. pyogenes Hyg Chen pHSN501 AtU6-26 BsaI yes,...
  10. Antibody Guide

    Type
    Collection
    ...signaling molecules, as some buffer components can interfere with the conjugate or conjugation process. Sodium...used as an antimicrobial agent. Other chemical interferences with conjugating reactions are possible. It ... antibody to specifically bind to a protein is powerful, but in order to utilize it in the lab, researchers...fluorophores. Horseradish peroxidase (HRP) HRP performs a chemiluminescent reaction in the presence of...activated and its output measured. This method can be performed using the indirect detection method via a conjugated...protein complexes for downstream analysis. They are powerful tools for understanding protein or protein interactions...above. Reverse the crosslink, isolate DNA, and perform downstream analysis. Special considerations One...
  11. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ... High-performance GFP-based calcium indicators (Constitutive or Cre-dependent) High-performance calcium...:547-63. Sergio Grinstein pH Superfolder pHluorin pH sensor A superfolder variant of pH-sensitive pHluorin...chloride sensitivity, photostability and reduced ph interference demonstrates augmented transmembrane chloride...Citron/Citroff), mitochondrial or cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically...Voltage Voltage Sensitive Fluorescent Protein (VSFP/Butterfly) Knopfel Lab VSFP Plasmids Thomas Knopfel Voltage... Near-infrared fluorescent voltage indicator nirButterfly Screening and Cellular Characterization of Genetically...
  12. CRISPR Plasmids - Repress Gene Expression

    Type
    Collection
    ... CRISPR Interfere CRISPR Plasmids: Interfere Browse CRISPR Plasmids By Function...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target...
  13. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...and using Cas9-based genome engineering tools to perform different types of genome targeting. They are very...isolate single-cell colonies, grow them up, then perform individual genotyping (using Sanger sequencing,.... You could then confirm this purification by performing a genotyping assay (such as Sanger sequencing... 500ng of 293FT genomic DNA as template after performing gDNA purification and have tried conditions with...recommends using the Epicentre QuickExtract solution to perform this step to extract genomic DNA from cells. The...
  14. Antibody Production

    Type
    Collection
    ...not compatible for use in live cells and will interfere with conjugation. For applications such as these...recommended applications. The specific QC experiments performed varies for each antibody catalog item. Whenever...Whenever possible, the experiment is performed in parallel with a previous lot of recombinant antibody or the.... To learn which specific QC experiments were performed on your lot, please email [email protected] . Immunocytochemistry...
  15. CRISPR Plasmids - Yeast

    Type
    Collection
    ...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a ...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target...
  16. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing.... Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a ...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target...
  17. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...Insert Promoter Selectable Marker PI Publication Interfere Catalytically dead dCas9, or dCas9 fused to a ...like KRAB, can knock down gene expression by interfering with transcription. Design your gRNA to target...
  18. Genetic Code Expansion

    Type
    Collection
    ...aminotyrosine Mammalian Huiwang Ai 157925 pMAH-POLY-eRF1(E55D) POLY-eRF1(E55D) E. coli para-substituted phenylalanine...182653 pcDNA3.1(+)_U6 tRNAPyl_CMV NESPylRS(AF)_IRES_eRF1(E55D)-HA Y306A/Y384F (AF) pyrrolysine (Pyl) tRNA...
  19. CRISPR Plasmids - Epigenetics

    Type
    Collection
    ...Prime Edit Transcriptional Regulation Activate Interfere Epigenetics RNA Targeting RNA Targeting RNA Editing...heritable in dividing cells. CRISPR Activate and Interfere technologies also indirectly modify local chromatin...
Showing: 1 - 20 of 75 results