Skip to main content
Addgene

We narrowed to 31 results for: hal.1

Showing: 1 - 20 of 31 results
  1. Biosensor AAV Preps

    Type
    Collection
    ...none Constitutive 1 Looger 137955 pAAV.CAG.iAChSnFR CAG iAChSnFR none Constitutive 1, 9 Looger 121922 ...Constitutive 1, 9, rg* GENIE 162379 pGP-AAV-syn-FLEX-jGCaMP8f-WPRE Syn jGCaMP8f none Cre dependent 1, 5, 9, ...dependent 1, 5, 9, rg* GENIE 169258 AAV-hSyn-Soma-jGCaMP8f Syn soma-jGCaMP8f none Constitutive 1, 9, rg*...Constitutive 1, 5, rg* Looger 176753 AAV-mDlx-jGCaMP8f-WPRE Dlx jGCaMP8f none Constitutive 1, 9, rg* Looger...Constitutive 1, 9, rg* Looger 176759 pZac2.1-GfaABC1D-lck-jGCaMP8f GfaABC1D jGCaMP8f none Constitutive 1, 9 Looger...Constitutive 1, 5, 9, rg* GENIE 162377 pGP-AAV-syn-FLEX-jGCaMP8s-WPRE Syn jGCaMP8s none Cre dependent 1, 9, rg...dependent 1, 9, rg* GENIE 167572 AAV-hSyn-Ribo-jGCaMP8s Syn ribo-jGCaMP8s none Constitutive 1 Fyhn 169256...
  2. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...accumulation in bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based...elegans. Proc Natl Acad Sci U S A. 2019 Aug 1. Alexander Gottschalk Voltage Near-infrared fluorescent voltage...of cellular physiology. Nat Commun. 2020 Aug 4;11(1):3881. Adam Cohen Calcium GCaMP6f expression in forebrain...Dynamics in High-Ca Organelles. Cell Chem Biol. 2016 Jun 1. pii: S2451-9456(16)30163-5. Teresa Alonso , Javier... intracellular calcium. Nat Commun. 2021 Dec 9;12(1):7159. Dorus Gadella Calcium Teal genetically encoded...Neurophotonics. 2024 Apr;11(2):024207. doi: 10.1117/1.NPh.11.2.024207. Robert Campbell Calcium Ratiometric...orange-emitting fluorescent proteins. Nat Commun. 2017 Sep 5;8(1):431. Wolf Frommer Calcium Red-, yellow-, or cyan-...
  3. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Fawzi 127194 RP1B FUS 1-163 QQ4xSS #1 FUS His T7 ALS Nicolas Fawzi 127195 RP1B FUS 1-163 QQ4xSS #2 FUS His... type 1 scFv [L24/1] ITPR1 CMV Spinocerebellar ataxia James Trimmer 206790 IP3 receptor, type 1 scFv [... pLKO.1 mTagBFP2 rat DJ-1 shRNA PARK7 U6 Parkinson's Timothy Ryan 223563 pmCherry-Synaptojanin-1-145 SYNJ1... pHTN-HaloTag_C9orf72:1-481 C9orf72 Halo CMV ALS Cheryl Arrowsmith 210987 pHTC-HaloTag_C9orf72:1-481 C9orf72...Cookson 13321 pGEX5X.1 PINK1 WT PINK1 GST tac Parkinson's Mark Cookson 13322 pGEX5X.1 PINK1 KD PINK1 GST... His, V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's... His, V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's...
  4. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...oligos 1:10 in ddH 2 O ( e.g., 1.0 μl annealed oligos + 9.0 μl ddH 2 O to yield a concentration of 1 μM)....35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10 min. Optimize PCR ...sgRNAs manually or using freely available online tools 1 . Use these tools to help identify guide sequences...PAM) at the genomic recognition site. NOTE: Figure 1 describes possible deletion strategies for genes and... deletion of Pim1 in mouse ( Mus musculus ; Table 1 , Figure 2A ). NOTE: In this example, sgRNA-A’s protospacer...complement sequences of the Pim1 sgRNA from Table 1 are found in Table 2 . Obtain 24- or 25-mer oligos...SpCas9, but does not contain markers for selection 1 . Other constructs may be utilized, such as pX458 ...
  5. Optogenetics AAV Preps

    Type
    Collection
    ...Constitutive 1, 9 Svoboda 83898 pAAV-mDlx-ChR2-mCherry-Fishell-3 Dlx ChR2 mCherry Constitutive 1, 9, rg* Fishell...Constitutive 1, 2, 5, 9 Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ChR2/H134R EYFP Constitutive 1, 2, 5...Constitutive 1, 5, rg* Boyden 59171 pAAV-Syn-ChrimsonR-tdT Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden...dependent 1, 5, 9, rg* Deisseroth 26971 pAAV-CaMKIIa-eNpHR 3.0-EYFP CaMKII eNpHR 3.0 EYFP Constitutive 1, 9 ...Constitutive 1, 5, rg* Yizhar 125713 AAV-hSyn1-SIO-eOPN3-mScarlet-WPRE Syn eOPN3 mScarlet Cre dependent 1, 5 Yizhar...Constitutive 1, 5 Yizhar 198511 pAAV_hSyn-DIO-PdCO-mScarlet-WPRE Syn PdCO mScarlet Cre dependent 1, 5 Yizhar...Constitutive 1, 5 Yizhar 198516 pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE EF1a PdCO mScarlet Cre dependent 1, 5 Yizhar...
  6. p53 Pathway

    Type
    Collection
    ...-phase expressed 1; also known as GTSE1 BAI-1 Brain-specific angiogenesis inhibitor 1 Bax BCL2-associated...inhibitor type 1), member 1 PERP TP53 apoptosis effector PIDD p53-induced death domain protein 1 PIGs Etoposide... Name 14-3-3-σ Stratifin Apaf-1 Apoptotic peptidase activating factor 1 ATM ATM serine/threonine kinase...kinase 4 or 6 CHK1 Checkpoint kinase 1 CHK2 Checkpoint kinase 2 Cop-1 Ring finger and WD repeat domain 2...receptor superfamily, member 10b E2F-1 E2F transcription factor 1 Fas Fas cell surface death receptor ...SESN1 SESN2 SESN3 Sestrins 1, 2, or 3 Siah Siah E3 ubiquitin protein ligase 1 TSC2 Tuberous sclerosis 2...Noxa Phorbol-12-myristate-13-acetate-induced protein 1; also known as PMAIP1 p14ARF Cyclin-dependent kinase...
  7. Validated gRNA Sequences

    Type
    Collection
    ... Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA 59928 cut S. pyogenes 25161212 Fire rde-1(H974) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927...csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes...
  8. Immunology Research Plasmids and Resources

    Type
    Collection
    ...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7... TAPBP-R, TAPBPR THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential...variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin lambda variable 3-1 IGLV31, V2-1 IGLV3-10 immunoglobulin lambda...NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif) ligand 14 CC-1, CC-3, CKb1, FLJ16015, HCC-1, HCC... 3 G0S19-1, LD78ALPHA, MIP-1-alpha, MIP1A, SCYA3 CCL3L1 chemokine (C-C motif) ligand 3-like 1 464.2, D17S1718...GPD, GpFy, WBCQ1 DEFA1 defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha...
  9. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Institute ID Tag Protein Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP ...TJP1-mEGFP AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP ...Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi 109122 NPM1-mEGFP AICSDP-50 mEGFP Nucleophosmin... HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin...Nucleolus (granular component) 133963 UBTF-HaloTag AICSDP-80 HaloTag Nucleolar transcription factor UBF Nucleolus...
  10. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...aeruginosa PA14 234855 (Set 1) 1000000254 Inhibition P. aeruginosa X. Liu NA 1 5,981 (Set 1) 5,971 (Set 2) CHyMErA... Human Doench 3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313...Version 1 1000000069 Knockout Human Moffat 3rd 12 176,500 Toronto KnockOut - Version 3 90294 (1 plasmid...Libraries 153101-153106 Knockout Yeast Borodina N/A 1 Varies Bovine CRISPR Knockout Libraries 213927, 213928...pgRNAs 1,718 Broad GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and...Root 3rd 4 76,441 Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and...and Root 3rd 4 3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and...
  11. TALENs for Endogenous Zebrafish Genes

    Type
    Collection
    ...TATGGTGTCAAACCACAGtgcatgatgactgtctTTCCAGTCTGACCGATGA Dlk1 (site #1) TAL3240 & TAL3241 TGGTGGCGCAGCAGAGGGagctgatccaggaccaGGCCACCGTGAACATCA...TACAAGACAGGGGACAGAagctaaactcatggactgCACAGCTAAGGTAAGA hemogen (site #1) TAL3274 & TAL3275 TGGAAGACCCGTTGGAGAaagagatcccaccaacTGAAATAAAAGATTCAGA...TCTTCCGTTTCCACATCCaccacatcccaacagagcAGCGGGAGCAGCAGTAAA hif1al (site #1) TAL3278 & TAL3279 TGTTTCAGCAGAGCCCCGctgaagagctccccatGGAGATGGAAGGAGTGGA...TGATCCTCTGGCCCATTAacgactcctgggccaaCTCAAGTAGGGGAAACGA Park2 (site #1) TAL 3012 & TAL 3013 TGGAGCAGGGTGCGAGTGtgtctgagctgaaggaGGCGGTGGGTCGTTTACA...TTTCCTCTCATAGTCAATattaattctctatttgGCTCAAAATGTCAGTAAA Plekho1b-1 TAL3142 & TAL3143 TCGTCAAAGCGGGGCCCTcaggatgccaatcaacAGCCTGTGCAGCCCGACA...TATAGCATGATGATGGAAacggaccttcattcccCGGGACCCCAAACCAACA sox2 (site #1) TAL3178 & TAL3179 TGGAAACCGAGCTGAAGCccccggcgccccagcccaACACCGGGGGCACGGGGA...TTGCTCCTTGGTTGCATCtctgtcttcattatcaCAAACATTTTCTTCATTA tetmethylcytosinedioxygenase 1 TAL3572 & TAL3573 TCAACTCGCGCATCCACAaagcgaaatgttaagaGGGTGAAGGCTTCCATGA...
  12. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous Type II bacterial...separated by short palindromic repeat sequences. (1) The CRISPR array is transcribed to make the pre-CRISPR...engineering, with Type V following in 2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain...enChIP) using CRISPR. Biochem Biophys Res Commun . 439(1):132-6. PMID: 23942116 Gilbert LA, Horlbeck MA, Adamson...CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol . 35(1):31-34. PMID: 27918548...WX, Scott DA, Gootenberg JS, Kriz AJ, Zetsche B, Shalem O, Wu X, Makarova KS, Koonin EV, Sharp PA, Zhang...Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. 2015. CETCh-seq: CRISPR epitope...
  13. Zhang Lab CRISPR Page

    Type
    Collection
    ...Heidenreich 1, Banerjee A, Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol . 2015 Jan;33(1):102-6...SpCas9 alone without sgRNA. Full references are below. 1. SpCas9 (or SpCas9n, D10A nickase) + single guide ...screens. The libraries are available in two formats: 1 vector system - lentiCRISPR - sgRNA and SpCas9 together...):186-91. doi: 10.1038/nature14299. Epub 2015 Apr 1. PubMed . Return to AAV In vivo plasmids AAV Plasmids..., Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, Cradick TJ, Marraffini LA, Bao G, Zhang F. Nat... CRISPR-Cas9 knockout screening in human cells. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen...genome-wide libraries for CRISPR screening. Sanjana NE, Shalem O, Zhang F. Nat Methods . 2014 Aug;11(8):783-4....
  14. Genetic Code Expansion

    Type
    Collection
    ...Bacterial TAG Farren Isaacs 73545 pEvol-pAcFRS.1.t1 pAcFRS.1.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73547 pEvol-pAzFRS.1.t1 pAzFRS.1.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial...7FTrp) Bacterial TAG Thomas Huber 207639 pEVOL-NBK-1 PylRS M. mazei Pyrrolysine Bacterial Cole DeForest...and tyrU gene replaced by GentR) and release factor 1. Expresses archaeal MjTyrRS/tRNA pair instead. For... 160377 pDule-Mb haloTyrRS C6 C6 HaloTyrosine tRNA synthatase M. barkeri Halotyrosine Amino Acids Bacterial...160378 pDule2-Mb haloTyrRS C6 C6 HaloTyrosine tRNA synthatase M. barkeri Halotyrosine Amino Acids Bacterial...pylRS nitroY/haloY-F5 PylRS M. alvus 3-nitrotyrosine (3-nitro-Y), 3-halotyrosine (3-halo-Y) Bacterial ...
  15. CRISPR Guide

    Type
    Collection
    ... most popular genome engineering approach. Figure 1: Overview of the basic CRISPR mechanism Engineered...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa...
  16. Deisseroth INTRSECT Collection

    Type
    Collection
    ...populations defined by multiple parameters. Figure 1: Examples of intersectional cell population definitions... as a proof-of-concept targeting approach in 2014 1 (using EYFP and ChR2-EYFP as payloads). This approach...interneurons encode fear memory. Nat Neurosci. 23(1):61-74. PubMed (Link opens in a new window) Hafner...Itch-Scratching Cycle via Descending Regulation. Neuron 101(1):45-59. PubMed (Link opens in a new window) Lazaridis..., Deisseroth K, Carlén M, Meletis K. 2019. A hypothalamus-habenula circuit controls aversion. Mol. Psychiatry... Osten P, Sabatini BL. 2019. Distinct Cortical-Thalamic-Striatal Circuits through the Parafascicular Nucleus...window) Marcinkiewcz CA, Mazzone CM, D'Agostino G, Halladay LR, Hardaway JA, DiBerto JF, Navarro M, Burnham...
  17. Plasmids for Stem Cell Research

    Type
    Collection
    ... with CRISPR activators. Nat Commun. 2018 Jul 6;9(1):2643. Otonkoski Lentivirus Human Expression of human...cell reprogramming. Stem Cell Res Ther. 2017 Jun 5;8(1):132. Zovein Replicating EBNA1 episome Human Non-integrating...vector. Proc Natl Acad Sci U S A. 2009 Jan 6. 106(1):157-62. Jaenisch Lentivirus Mouse Doxycycline-inducible...transcription factors. Stem Cell Reports. 2015 Jan 13;4(1):25-36. Broccoli Fibroblasts Sensory Neurons Lentiviral...peripheral sensory neurons. Nat Neurosci. 2015 Jan;18(1):25-35. Baldwin Fibroblasts iTSCs Lentiviral Mouse... from Human ALS Patients. Cell Rep. 2016 Jan 5;14(1):115-28. Zhang Adult Dermal Fibroblasts Neurons Lentiviral... into Neurons. Curr Protoc Cell Biol. 2018 Jun;79(1):e51. Next generation vectors for transcription factor...
  18. Mammalian RNAi Tools

    Type
    Collection
    ... design and delivery, see resources below. Figure 1: Overview of shRNA-mediated RNA interference. Created...Publication Additional Resources Addgene Resources pLKO.1 cloning vector protocol Other Addgene viral protocols...PubMed (Link opens in a new window) . Dana, H., Chalbatani, G. M., Mahmoodzadeh, H., Karimloo, R., Rezaiean...
  19. Tetracycline Inducible Expression

    Type
    Collection
    ...and releases tet O, enabling transcription (Figure 1). While TetR and tet O could be a basic tool to control...skip ahead to view highlighted Tet plasmids . Figure 1: Tet-regulated expression systems. Left: natural TetR...although the DNA-binding profile is reversed (Figure 1). However, rtTA can induce stronger expression of ...Transactivator PI 26429 pLenti CMV rtTA3 Blast (w756-1) Lentiviral Tet-On vector with blasticidin selection...Mikhail Alexeyev 17492 pLenti CMV TetR Blast (716-1) Lentiviral Tet-On vector expressing TetR from CMV... good tissue distribution, low toxicity, a known half-life (24 hours), and is relatively inexpensive. ...
Showing: 1 - 20 of 31 results