Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 75 results for: ache

Showing: 21 - 40 of 75 results

  1. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...Cas9 nuclease form a complex with each individual, unique crRNA. (4) Each crRNA:tracrRNA:Cas9 complex seeks...Doyon Y. 2015. A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells...722-36. PMID: 26411297 Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM. ...

  2. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...for surface proteins and use enzymatic binding to attach substrate Control plasmids with a recognizable ...expressed and purified as described previously in Stachelhaus et al. (1998) References George N, Pick H, Vogel...J Am Chem Soc. 126(29):8896-7. PMID:15264811 Stachelhaus T, Mootz HD, Bergendahl V, Marahiel MA.1998. ...

  3. p53 Pathway

    Type
    Collection
    ...multiple isoforms or subunits, individual links to each gene page are provided below. Color is used for ...multiple isoforms or subunits, individual links to each gene page are provided below. Symbol Name 14-3-3...early ageing-associated phenotypes. Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, Igelmann ...

  4. TALEN Guide

    Type
    Collection
    ...amino acid repeats. These repeats only differ from each other by two amino acids, their repeat-variable ... still determining the importance of context for each TAL effector within an array, but early studies ...Addgene’s history. Dr. Keith Joung’s lab at Massachusetts General Hospital also recently released a TALEN...

  5. Viral Vectors

    Type
    Collection
    ...present for a viral particle or virion to be produced. Each of these plasmids, however, retains the properties... of viruses that are commonly used for research, each of which exhibit different properties, and thus,...detailed information can be found in the guides for each virus type, linked above. Virus Expression Genome...

  6. Viral Production

    Type
    Collection
    ...using standard methods that have been optimized for each specific virus in order to generate high quality...ddPCR are generally 2–3 fold higher than those achieved using the standard qPCR method. Titering by the...The specific QC experiments performed varies for each viral lot. To learn which specific QC experiments...

  7. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...consist of thousands of plasmids, each containing multiple gRNAs for each target gene. In a CRISPR screening...and target species. Additional information about each library can be found on the individual library ...

  8. Plasmids for Stem Cell Research

    Type
    Collection
    ...body during development. Unlike other cell types, each stem cell has the potential to either remain a stem...use. Since 2006, scientists have developed many approaches to generate iPSCs. The generation of iPSCs is...Xeno-Free Culture Conditions: A Clinically Compliant Approach. Stem Cells Transl Med. 2015 Mar 5. pii: sctm.2014...

  9. Allen Institute for Brain Science AAV Enhancer Collection

    Type
    Collection
    ...Huang C, Huff S, Hunker A, Johansen N, Juneau Z, Kalmbach B, Khem S, Kussick E, Kutsal R, Larsen R, Lee ...Graybuck LT, Daigle TL, Sedeño-Cortés AE, Walker M, Kalmbach B, Lenz GH, Morin E, Nguyen TN, Garren E, Bendrick..., Kojima Y, Ding Y, Somasundaram S, Miller JA, Kalmbach BE, Radaelli C, Gore BB, Weed N, Omstead V, Bishaw...

  10. Validated gRNA Sequences

    Type
    Collection
    ...AAAGGTCGAGAAACTGCAAA 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut...TGAAGAAAGTTATACTCGA 66099 cut S. pyogenes 25249454 Seydoux T (BRACHYURY) H. sapiens CACGCGCAGTTCGCGCTCTG 59726 cut S. ...GGCTCCCTTCAAGTGGGATG 70658 cut S. pyogenes 26472758 Sabatini BACH2 H. sapiens AATGTAGCGATTGAGAGTGTGGG 71828 methylation...

  12. Cancer Research Plasmids and Resources

    Type
    Collection
    ...mutant, knockdown, and overexpression constructs. Each collection page listed below organizes the plasmids...extremely important for classification and treatment. On each pathway page, click on a component to find plasmids...

  13. AAV Viral Preps

    Type
    Collection
    ...titers are listed on each item's material page. Actual titers are reported with each shipment. If you can't...

  14. AAV Molecular Tools

    Type
    Collection
    ...of axon terminals. 1 Luo 60658 pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato EF1a-driven, Flp-dependent Flp-dependent...Flp-dependent expression of the voltage-gated Na+ channel mNaChBac and (physically separate) tdTomato 8 Scanziani...

  15. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...single round of viral entry and infection. This approach allows researchers to safely study mechanisms ...SARS-CoV-2 Spike protein and you will find examples of each in Addgene's collection: HIV-based lentiviral particles...

  16. Worm Expression Resources

    Type
    Collection
    ... Editing in Caenorhabditis elegans. A modified approach has also been developed by the Fire laboratory...Other Resources Addgene Blog Posts An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency Fluorescent...

  17. Lentiviral Prep Service

    Type
    Collection
    ...titers are listed on each item's material page. Actual titers are reported with each shipment. For more ...

  19. Ras Pathway

    Type
    Collection
    ...multiple subunits or isoforms, individual links to each gene page are provided below. Color is used for ...multiple subunits or isoforms, individual links to each gene page are provided below. Symbol Name AKT AKT1...

  20. TALEN Plasmids and Kits

    Type
    Collection
    ...is driven by the strong CAG promoter or can be achieved by in vitro mRNA synthesis from the T7 promoter...Gate TALEN 2.0 47388 pcDNA3.1-GoldenGate Charles Gersbach These new destination vectors can be used to create...
Showing: 21 - 40 of 75 results