Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene
Showing: 1 - 20 of 77 results
  1. EXtracellular Plasmid RESource (EXPRESs) Consortium

    Type
    Collection
    ...Consortium plasmids that encode the extracellular regions of cell surface receptor and secreted proteins as...expression plasmids that encode the extracellular regions of cell surface receptor and secreted proteins as...AVEXIS (for Avidity-based extracellular interaction screen) in which the extracellular regions of receptor ... Plasmid Collections EXPRESs Plasmids EXtracellular Plasmid RESource (EXPRESs) Consortium You may...inserts that encode the whole ectodomains of cell surface receptors are flanked by two 8 bp cutting enzymes...Zebrafish antibody plasmids P. falciparum merozoite surface protein plasmids P. vivax merozoite protein plasmids...blood stage proteins P. falciparum sporozoite cell surface and secreted proteins Mouse sperm Mouse egg Laboratories...
  2. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...Transitions. ACS Sens. 2020 Mar 27;5(3):814-822. Bas Teusink ATP (extracellular) ecAT3.10 extracellular ATP sensor...cytosolic Zn(2+). ACS Chem Biol. 2013 Nov 15;8(11):2366-71. Amy Palmer Zinc Cell surface localized zinc ...Mitochondrial Matrix and Intermembrane Space with the GZnP2 Sensor. ACS Chem Biol. 2018 Jul 20;13(7):1897-...fluorescent voltage sensor to detect neural activity (Ace-mScarlet) A high-speed, bright, red fluorescent voltage...for Cytosolic and Intraorganelle Zn(2+) Imaging. ACS Chem Biol. 2015 Sep 18;10(9):2126-34. Maarten Merkx... ADP based on tetramethylrhodamine-labeled ParM. ACS Chem Biol. 2010 Apr 16;5(4):415-25. Martin Webb ATP...Linkers between a Fluorescent Protein and PDE5alpha. ACS Sens. 2017 Jan 27;2(1):46-51. Tetsuya Kitaguchi cGMP...
  3. Zebrafish Plasmid Collection

    Type
    Collection
    ...modified CRISPR-Cas9 system - Shuo Lin Lab Re-purposed Ac/Ds transgenic system enabling CRISPR/dCas9-interference...receptors or monoclonal antibodies to zebrafish cell surface receptors and secreted proteins. Return to top ...
  4. CRISPR Guide

    Type
    Collection
    ...higher efficiency and product purity. 2017. Komor AC, Zhao KT, Packer MS, Gaudelli NM, Waterbury AL, Koblan...engineering and protein delivery. 2017. Rees HA, Komor AC, Yeh WH, Caetano-Lopes J, Warman M, Edge ASB, Liu...Cas9-cytidine deaminase fusions. 2017. Kim YB, Komor AC, Levy JM, Packer MS, Zhao KT, Liu DR. Nat Biotechnol...DNA without DNA cleavage. 2017. Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR...without double-stranded DNA cleavage. 2016. Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. Nature . 533...The target is present immediately adjacent to a P rotospacer A djacent M otif (PAM). The PAM sequence serves...codons that make up a gene PAM P rotospacer A djacent M otif; Sequence adjacent to the target sequence that...
  5. Deisseroth INTRSECT Collection

    Type
    Collection
    ...S, Yetnikoff L, Kalmbach A, Ma T, Ztaou S, Sienna AC, Tepler S, Poulin JF, Ansorge M, Awatramani R, Kang...
  6. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...specificities. Nature . 523(7561):481-5. PMID: 26098369 Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR. 2016. Programmable...contain a species-specific sequence known as a protospacer adjacent motif (PAM). The CRISPR complex binds to...contains many unique protospacer sequences that have homology to foreign DNA. Protospacers are separated by...sequence is only valid if it contains a special Protospacer Adjacent Motif (PAM) directly after where the crRNA...Adaptive Immune System CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat) sequences were initially... development has occurred at a truly astonishing pace, with work directed towards increasing on-target...target RNA rather than DNA, sometimes requiring a protospacer flanking sequence (PFS). In bacteria, Cas13 targeting...
  7. Church Lab CRISPR Plasmids

    Type
    Collection
    ...sequence by the gRNA, but only if the correct protospacer-adjacent motif (PAM) is present at the 3′ end (see...slowly than those expressing SP and ST1. Protospacer-adjacent motifs (PAMs): Please note that NM, ST1,...reporter: protospacer B 48662 SK-YFP-ST1-B Bacterial ST1 repression YFP reporter: protospacer B 48663 SK-YFP-TD-B...reporter: protospacer B 48664 SK-YFP-NM-A Bacterial NM repression YFP reporter: protospacer A 48665 SK-YFP-ST1...reporter: protospacer A 48666 SK-YFP-TD-A Bacterial TD repression YFP reporter: protospacer A 48667 EE-SP...adaptive immune defenses termed clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated...combinations of highly unfavorable bases at positions adjacent to those formally required can significantly reduce...
  8. Zhang Lab's CRISPR Frequently Asked Questions

    Type
    Collection
    ...want to use double nickase, you could express two spacers and use PX335 to express the Cas9n (nickase). The...PAM sequence to the oligo when cloning my target spacers into the PX330 vector backbone? There is no need...usually adds it when they order the oligo. If your spacer sequence starts with a 'G', you naturally have ... compared to where the target site sequence (protospacer+PAM) is located? If there are other PAMs in the...only matter if the PAM sequence is immediately adjacent to the nearly-homologous target sites. The mere... there needs to be extensive homology of the protospacer followed by PAM. Click here for a target selection... together, with each plasmid having a targeting spacer cloned into the backbone ( pX330 or PX335 , depending...
  9. Genetic Code Expansion

    Type
    Collection
    ... Nε-acetyl-L-lysine Bacterial TAG David Liu 104071 pTECH-MmAcK3RS(IPYE) AcK3RS M. mazei Nε-acetyl-L-lysine...thermophila acetyl-lysine Mammalian Tao Liu 164081 pCMV-MfPylRS (human-opti) PylRS M. flavescens acetyl-lysine...thermophila acetyl-lysine Mammalian Tao Liu 164196 pCMV-MfBulKRS (human-opti) BulKRS M. flavescens acetyl-lysine...expressed from a plasmid containing a UAG codon at the place where the new amino acid would be incorporated. ...-DnpK PylRS M. barkeri N6‐(2‐(2,4‐dinitrophenyl)acetyl)lysine (DnpK) Bacterial, Mammalian TAG Huiwang ...140021 pAS_4xMma PylT_FLAG-AcKRS AcKRS M. mazei acetyl-lysine Mammalian TAG Simon Elsaesser 140022 pAS...Huber 177311 pRSF-G1TFAKRS M. archaeon N6-(trifluoroacetyl)-L-lysine (TFA-Lys) Bacterial TAG Thomas Huber...
  10. COVID-19 Resources

    Type
    Collection
    ...membrane fusion function.( 5 ) TACE - (ADAM17) a metalloprotease that cleaves hACE2, potentially increasing ...Protein Upstream of Rather than Adjacent to the Fusion Peptide . TACE - Heurich A, et al , 2014, J Virol...cellular receptor for SARS-CoV-2 and SARS-CoV is hACE2, an angiotensin receptor. Another key step is the...Collection page. SARS-CoV-2 Pooled Libraries - Yeast surface display libraries of Spike (S) Ectodomain and RBD...having a key role in coronavirus infection, such as ACE2 and TMPRSS2, which are involved in the entry of ...these genes, see the links and references below: ACE2 - (Human Angiotensin Converting Enzyme 2) is the... SARS-CoV-2 spike RBD and block interaction with ACE2. Huo, et al. Nat Struct Mol Biol. 2020 Jul 13. SARS-CoV...
  11. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ... cell surface localization 101131 pACP-GPI Control Plasmid ACP/MCP-tag Control for cell surface localization...used in live or fixed cells, and for internal or surface proteins Single constructs are compatible with ...agents) ACP- and MCP-tags are used exclusively for surface proteins and use enzymatic binding to attach substrate...are particularly well suited for labeling cell-surface proteins, and are useful for labeling secreted ...pSNAPf-ADRβ2 Control Plasmid SNAP-tag Control for cell surface localization 101136 pCLIP-tag (m) Vector CLIP-tag...pCLIPf-NK1R Control Plasmid CLIP-tag Control for cell surface localization 101127 pMCP-tag (m) Vector ACP/MCP-tag...pACP-ADRβ2 Control Plasmid ACP/MCP-tag Control for cell surface localization Supplemental Information SNAP and ...
  12. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ...of a 20-mer (“protospacer sequence”) upstream of an “NGG” sequence (“protospacer adjacent motif” or PAM...Abstract The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated...Figure 2A ). NOTE: In this example, sgRNA-A’s protospacer sequence and PAM happen to fall on the bottom...bottom (Crick) strand while sgRNA-B’s protospacer sequence and PAM fall on the top (Watson) strand ( Figure...will occur independent of orientation of the protospacer sequence/PAM relative to the top or bottom strand...However, if the first position of the 20-mer (protospacer sequence) is G, do not add another G ( e.g., ...samples on 2% agarose gel at 10 V/cm using 1x Tris-acetate-EDTA (TAE) buffer. Examine samples for the presence...
  13. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ... Anti-Pan-Neurofascin (extracellular) [A12/18R] Pan-Neurofascin (extracellular) Rat Mouse IgG2a 177439...Anti-Kv1.4 K+ channel (extracellular) [L71/5R] Kv1.4 K+ channel (extracellular) Rat Mouse IgG2a 177489...Mouse IgG2a 177564 Anti-ADAM22 (extracellular) [N57/2R] ADAM22 (extracellular) Mouse Mouse IgG2a 177565 Anti-GluN2B...Anti-Kv1.4 K+ channel (extracellular) [L71/22] Kv1.4 K+ channel (extracellular) Rat Mouse IgG2a 190292...-Neurofascin (extracellular) scFv [A12/18] A12/18 scFv 2t Pan-Neurofascin (extracellular) Rat Mouse 190486...Kv1.4 K+ channel (extracellular) scFv [L71/5] L71/5 scFv Kv1.4 K+ channel (extracellular) Rat Mouse 190518... Mouse 190537 LRP4 (extracellular) scFv [N207/27] N207/27 scFv LRP4 (extracellular) Mouse Mouse 190538...
  14. Validated gRNA Sequences

    Type
    Collection
    ...lC.GA4a B. oleracea GTTGAGAGGGGAGCCGGTGA 68256 cut S. pyogenes 26616834 Patron lC.GA4a B. oleracea GTTTTCACTTGCGGCCGGAG...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N....N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis...meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church...Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S. thermophilus 24076762 Church Protospacer...TACCATCTCAAGCTTGTTGA 48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T....
  15. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...–6 67,366 (Set A) 67,194 (Set B) Cas13a/C2c2 Protospacer flanking site (PFS) Library 79153 Knockout E....E. coli Zhang N/A N/A N/A - The protospacers contained in the library represent all 4096 (4 6 ) combinations...Knockout Human J. Chen 3rd 10 4,530 Murine Cell Surface Protein Knockout (McspKO) Library 200445 Knockout...Sabatini and Lander 3rd 10 Varies FNLCR CRISPRa Cell Surface Libraries 207471 1000000228 Activation Human Chari...
  16. Distribution to Industry

    Type
    Collection
    ...account, you can place orders through our website. Please note that all orders must be placed online through...Information Featured Collections COVID-19 SARS-COV-2, ACE2, and CRISPR tools Fluorescent Proteins from the ... account has been verified, you will be able to place your order on our website. Placing an Order: After...Center . The MTA Process: Once your order has been placed on our website, Addgene will email you a link to...
  17. Antibody Guide

    Type
    Collection
    ...suspended in the original media or isolated and placed in a buffer. Antibody Structure Figure 1: Structure...of 4 IgA1; IgA2 IgD Coexpressed with IgM on the surface of most immature B cells; function is unknown Monomer...by a capture antibody (sandwich). Block unused surface-binding sites in the wells with a blocking protein...sandwich ELISA, a capture antibody, bound to a surface, is used to capture the protein of interest and...In IHC, tissue sections are assayed and the extracellular matrix remains intact. The signaling molecule...enzyme. In ICC, cells have most or all of their extracellular matrix removed. Again, the signaling molecule...cells. Cells, with labeled antibodies bound to surface receptors, are “flowed” through a flow cytometer...
  18. Plasmids for AVEXIS screening

    Type
    Collection
    ...-based extracellular interaction screen to detect protein interactions, where the extracellular regions...Large-scale screening for novel low-affinity extracellular protein interactions. Bushell KM et al., Genome...for the identification of novel low-affinity extracellular protein interactions Sun Y et al., Analytical...
  19. EXPRESs Plasmids for Zebrafish Receptors

    Type
    Collection
    ...plasmids that was used for systematic screening of extracellular protein interactions to identify novel receptor-ligand...Large-scale screening for novel low-affinity extracellular protein interactions. Bushell KM et al., Genome... 2008 Apr;18(4):622-30. PubMed 18296487 A cell surface interaction network of neural leucine-rich repeat...R99 PubMed 19765300 Construction of a large extracellular protein interaction network and its resolution...
Showing: 1 - 20 of 77 results