...mutations to alter the absorption spectrum or adding trafficking signals to localize opsins to the cell membrane...research, helping scientists to better understand Parkinson’s disease, depression, drug addiction, and more...), C1V1(t/t), ChIEF Increased channel (on/off) kinetics: Examples: ChETA, C1V1(t/t), ChrimsonR Red-shifted...CrChR2 450 ChETA E123T mutation; creates faster kinetics but reduces photocurrent amplitude 490 ChR/T159C...activity 589 eNpHR 3.0 NpHR with addition of trafficking signal from Kir2.1 and ER export signal provide...sodomense 566 eArch 3.0 Arch with addition of trafficking signal from Kir2.1 566 ArchT Light-activated ... Arch. 566 eArchT 3.0 ArchT with addition of trafficking signal from Kir2.1 566 Leptosphaeria rhodopsins...

... Technology Molecular Cloning Plasmid Elements Working with Plasmids Introduction Types of Plasmids Cloning...to break chromosomes down to study their genes, marking the birth of molecular genetics. Today, scientists...primers check out Addgene's sequencing primer list. Working with Plasmids Plasmids have become an essential...entry vectors and TOPO cloning vectors. If you are looking for an empty plasmid backbone for your experiment... number of E. coli strains below and recommend checking out these two Addgene blog posts relating to common...and their recommended concentrations. We suggest checking your plasmid's datasheet or the plasmid map to...Antibiotic Recommended Stock Concentration Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin...

...Single-Strand Break (Nick) , Double-Strand Break (Cut) Making Precise Modifications Using Homology Directed Repair...a specific sequence adjacent to the RNA target, making this a very flexible editing system. Editors based...sites was sufficient to repress transcription by blocking initiation. dCas9 can also be fused with transcriptional...target genes. In contrast, CRISPR is capable of making highly specific, permanent genetic modifications...Multicolor CRISPR imaging allows for simultaneous tracking of multiple genomic loci in living cells. One ...fluorescent CRISPR system has been used for dynamic tracking of repetitive and non-repetitive genomic loci,...Another limitation of SpCas9 is the low efficiency of making specific genetic edits via HDR. For specific point...

...important factor (for instance, looking for a different conjugate or looking for antibodies validated for...unused surface-binding sites in the wells with a blocking protein such as BSA, followed by several wash ... assay, called native ChIP, does not use cross-linking and instead relies on strong interactions between...the product information for similar antibodies, looking for ones that have identical features and epitopes...

...exhibited high levels of constitutive activity, making them less than ideal. DREADDs D esigner R eceptors... previously used in human populations in Japan, making it an attractive option for translational studies...engineered to respond specifically to the anti-smoking drug varenicline. This PSAM carries mutations at...antipsychotic drugs: is M1 agonism a pre-requisite for mimicking clozapine’s actions? Psychopharmacology 178:451...

...Reference Sequencing Primers Sequencing Primers Looking for Primers? The primer sequences listed on the...promoter, forward primer pcDL-F GTTGCCTTTACTTCTAGGCCT (Kinet lab) 5' of EcoRI site in pcDL vector, forward primer...reverse primer TK-pA-R TTGTCTCCTTCCGTGTTTCA Thymidine kinase polyA, reverse primer Tn7-end GGGGTGGAAATGGAGTTTTT...

... The entry clone now has recombined attL sites flanking your DNA fragment of interest. Now that your DNA...site-specific recombination or a ligation step, making it an easy, cheap and rapid cloning method. So ...

...see our Biosafety guide for more information on working with adenovirus. Overview of Adenoviral Plasmid...

...Please see our Biosafety page for information on working with retrovirus. Packaging using 293T cells This...

...Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible Tetracycline response element...

...their tropism, or the types of cells they infect, making AAV a very useful system for preferentially transducing...

...plasmids be used in direct transfections as opposed to making virus? Some (but not all) lentiviral transfer plasmids...