This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Addgene will be closed November 22nd & 23rd for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 19th - 23rd. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CRISPR Plasmids: Validated gRNAs


The table below lists experimentally validated gRNA plasmids designed to target various genes or genomic regions. It is highly recommended that you determine if your cell type contains the target sequence before using any of these gRNA plasmids and review the publication associated with each plasmid for more information on how it was originally used.

Here are a few questions to consider when choosing a gRNA:

Does a given gRNA sequence exactly match your genomic target? Variation between a given gRNA sequence and your genomic target may reduce the gRNA activity. Know your target.

Which species or variant of Cas9 (S. pyogenes, S. aureus etc.) was this gRNA sequence designed for? A given gRNA sequence may only be compatible with a single species or PAM binding variant of Cas9 (e.g. Wild-type SpCas9 must be used with targets that are upstream of a 5' NGG 3' PAM sequence).

Which CRISPR application is this gRNA sequence compatible with? CRISPR knockout experiments use targeting sequences within exons, whereas CRISPR activation or repression experiments use targets within promoters. When possible, the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate the Cas9 application the gRNA was designed to accomplish.

Do you have validated gRNAs you'd like to add to the Addgene collection? Click here to start the deposit process and have your plasmids added to the list. You can also email [email protected] for more information and assistance with the deposit process!


Validated gRNA Plasmids

Plasmid Gene/Insert Vector Type PI Publication
gRNA_AAVS1-T1gRNA_AAVS1-T1Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_AAVS1-T2gRNA_AAVS1-T2Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_GFP-T1gRNA_GFP-T1Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_GFP-T2gRNA_GFP-T2Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_DNMT3a-T1gRNA_DNMT3a-T1 (Homo sapiens)Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_DNMT3a-T2gRNA_DNMT3a-T2 (Homo sapiens)Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
gRNA_DNMT3bgRNA_DNMT3b (Homo sapiens)Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3.
Zebrafish-gRNA-0001gRNA-apoea (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0002gRNA-drd3 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0003gRNA-fh site #1 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0004gRNA-fh site #2 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0005gRNA-gsk3b (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0006gRNA-rgs4 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0007gRNA-th1 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0008gRNA-tia1l (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
Zebrafish-gRNA-0009gRNA-tph1a (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501.
pX261-U6-DR-hEmx1-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-purohumanized S. pyogenes Cas9Mammalian Expression, CRISPR Zhang Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013 Jan 3.
p426-SNR52p-gRNA.CAN1.Y-SUP4tCAN1.y gRNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR Church Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res
pCRISPR::rpsLCRISPR::rpsLCRISPR ; E.coli Marraffini RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2508.
PU6::unc-119_sgRNAunc-119 targeting sgRNA (Synthetic)CRISPR Calarco Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532.
PU6::klp-12_sgRNAklp-12 targeting sgRNA (Synthetic)Worm Expression, CRISPR Calarco Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532.
pT7EGFPgRNAegfp target (Synthetic)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.
pT7tyrgRNAtyr gRNA (Danio rerio)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.
pU6-sgGFP-NT1sgGFP-NT1Mammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pU6-sgGAL4-1sgGAL4-1, Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pU6-sgGAL4-4sgGAL4-4, Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pU6-sgCXCR4-2sgCXCR4 -2 (Homo sapiens), Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pU6-sgCD71-2sgCD71 -2 (Homo sapiens), Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pSNR52-sgTEF1sgTEF1 promoter (Saccharomyces cerevisiae)Yeast Expression, CRISPR Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pSNR52-sgTETsgRNA targeting endogenous TRE elements of pTET07 promoter (Saccharomyces cerevisiae)Yeast Expression, CRISPR Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.
pICH86966::AtU6p::sgRNA_PDSAtU6p::sgRNA_PDS (Synthetic)CRISPR ; Plant expression Kamoun Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655.
pVC297 VEGF Site#1gRNA-VEGF site 1 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pVC299 VEGF Site#2gRNA-VEGF site 2 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pVC228 VEGF Site#3gRNA-VEGF site 3 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pFYF1548 EMX1gRNA-EMX1 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pDR366 RNF2gRNA-RNF2 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pDR348 FANCFgRNA-FANCF (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pFYF1320 EGFP Site#1gRNA-EGFP site 1 (Synthetic)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pFYF1327 EGFP Site#2gRNA-EGFP site 2 (Synthetic)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pFYF1328 EGFP Site#3gRNA-EGFP site 3 (Synthetic)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623.
pDD122 (Peft-3::Cas9 + ttTi5605 sgRNA)Cas9 (Synthetic), ttTi5605 sgRNA (Other)Worm Expression, CRISPR Goldstein Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641.
pSimpleII-U6-tracr-U6-crRNA(tdTomato)-NLS-NmCas9-HA-NLS(s)NmCas9 (Other), U6pr-tracrRNA (Other), tdTomato crRNA (Synthetic)Mammalian Expression, CRISPR Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12.
pSimpleII-U6-tracr-U6-crRNA(OCT4)-NLS-NmCas9-HA-NLS(s)NmCas9 (Other), U6pr-tracrRNA (Other), OCT4 crRNA (Synthetic)Mammalian Expression, CRISPR Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12.
pT7goldRNAgolden gRNA (Danio rerio)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.
pT7mitfagRNAmitfa gRNA (Danio rerio)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.
pT7ddx19gRNAddx19 gRNA (Danio rerio)CRISPR Wente Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5.
PM-SP!TABacterial SP crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-SP!TBBacterial SP crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-NM!TABacterial NM crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-NM!TBBacterial NM crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-ST1!TABacterial ST1 crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-ST1!TBBacterial ST1 crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-TD!TABacterial TD crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
PM-TD!TBBacterial TD crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
EE-SP!gIIICas9 (Other), anti-gIII tracrRNA (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
M-SP-sgRNAsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681.
pAc-y1sgRNA-Cas9Cas9 (Synthetic), dU6-sgRNA (Drosophila melanogaster), y1 sgRNA (Drosophila melanogaster)Insect Expression, CRISPR Liu Mutagenesis and homologous recombination in Drosophila cell lines using CRISPR/Cas9. Biol Open. 2013 Dec 10. pii: bio.20137120v1. doi: 10.1242/bio.20137120.
pAGM4723::AtU6p::sgRNA2-2x35S-5′UTR::Cas9::NOST-AtU6p::sgRNA1sgRNA_PDS2-Cas9-sgRNA_PDS1 (Synthetic)Plant Expression, CRISPR Kamoun Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 2013 Oct 11;9(1):39.
pLX-sgRNAsgAAVS1Mammalian Expression, Lentiviral, CRISPR Sabatini Genetic screens in human cells using the CRISPR-Cas9 system. Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12.
pX330-Cetn1/1Cetn1 sgRNA1 (Synthetic), humanized S. pyogenes Cas9 (Other)Mammalian Expression, CRISPR Ikawa Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355.
pLKO.1-puro U6 sgRNA Oct4A -12Oct4A -12 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA Oct4A -158Oct4A -158 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA SOX17 -91Sox17 -91 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA SOX17 -126Sox17 -126 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA SOX17 -177Sox17 -177 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA SOX17 -296Sox17-296 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pLKO.1-puro U6 sgRNA CAGnegative control sgRNA (Other)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
pSLQ1651-sgTelomere(F+E)Optimized sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001.
pSLQ1661-sgMUC4-E3(F+E)optimized sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001.
pRS316-RGR-GFPRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.
pRS316-RGR-GFP-mHHRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.
pRS316-RGR-GFP-mHDVRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.
pRS316-RGR-GFP-mmRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152.
lentiCRISPR - EGFP sgRNA 1Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 1 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
lentiCRISPR - EGFP sgRNA 2Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 2 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
lentiCRISPR - EGFP sgRNA 3Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 3 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
lentiCRISPR - EGFP sgRNA 4Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 4 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
lentiCRISPR - EGFP sgRNA 5Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 5 (Synthetic)Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
lentiCRISPR - EGFP sgRNA 6Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 6 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12.
pMZ284rrk1-sgRNA (Schizosaccharomyces pombe)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pMZ285rrk1-sgRNA (Schizosaccharomyces pombe)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pMZ286rrk1-sgRNA (Schizosaccharomyces pombe)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pUC119-gRNAguide RNA targeting AtPDS3 (Arabidopsis thaliana)CRISPR ; Plant expression Sheen Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol. 2013 Aug;31(8):688-91. doi: 10.1038/nbt.2654.
pSAG1::CAS9-U6::sgUPRTSAG1 5' UTR (Other)CRISPR ; Toxoplasma expression Sibley Efficient Gene Disruption in Diverse Strains of Toxoplasma gondii Using CRISPR/CAS9. MBio. 2014 May 13;5(3). pii: e01114-14. doi: 10.1128/mBio.01114-14.
CMVp-dsRed2-Triplex-28-gRNA1-28-pAdsRed2 (Homo sapiens)Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022.
CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pAdsRed2 (Homo sapiens)Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022.
CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pAdsRed2 (Homo sapiens)Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022.
pCCM935unc-22 sgRNA (Caenorhabditis elegans)Worm Expression Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans. Genetics. 2014 May 30. pii: genetics.114.166389.
pAdSh.U6.gRNAS1U6.gRNAS1 cassette (Synthetic)Mammalian Expression, Adenoviral, CRISPR Goncalves Adenoviral vector delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi: 10.1038/srep05105.
pAdSh.U6.gRNAGFPU6.gRNAGFP cassette (Synthetic)Mammalian Expression, Adenoviral, CRISPR Goncalves Adenoviral vector delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi: 10.1038/srep05105.
pX330A-1x3humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.
pX330A-1x4humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.
pX330A-1x5humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.
pX330A-1x6humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.
pX330A-1x7humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.
pX330S-2humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.
pX330S-3humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.
pX330S-4humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.
pX330S-5humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.
pX330S-6humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.
pX330S-7humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400.
pCCM936avr-14 sgRNA (Caenorhabditis elegans)Worm Expression, CRISPR Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans. Genetics. 2014 May 30. pii: genetics.114.166389.
pCCM937avr-15 sgRNA (Caenorhabditis elegans)Worm Expression, CRISPR Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans. Genetics. 2014 May 30. pii: genetics.114.166389.
Human BLIMP1 sgRNAhBLIMP1 sgRNA (Homo sapiens)Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015
Human SOX17 sgRNAhSox17 sgRNA (Homo sapiens)Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015
Human T (BRACHYURY) sgRNAhT sgRNA (Homo sapiens)Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015
pSAG1::CAS9-U6::sg290860-6CRISPR sg290860-6CRISPR ; ; Toxoplasma gondii Sibley Genetic mapping reveals that sinefungin resistance in Toxoplasma gondii is controlled by a putative amino acid transporter locus that can be used as a negative selectable marker. Eukaryot Cell. 2014 Dec 5. pii: EC.00229-14.
pMZ288Cas9 (Other), rrk1:sgRNA (Other)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pMZ289Cas9 (Other), rrk1:sgRNA (Other)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pMZ381Cas9 (Other), rrk1:sgRNA (Other)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344.
pX330 PtensgRNA targeting Pten (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589.
pX330 p53sgRNA targeting p53 (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589.
pX330 Ctnnb1.1sgRNA targeting Ctnnb1 (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589.
pX330 Ctnnb1.2Ctnnb1 (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589.
pJA45rde-1(D718) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA46rde-1(D801) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA14rde-1(H974) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA42rol-6(su1006) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA50unc-58(e665) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA59unc-109(n499) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA58dpy-10(cn64) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
pJA55sqt-1(e1350) gRNA2 (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
U6>Ebf.774(F+E)Ebf.774 (F+E) sgRNACRISPR Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488.
U6>Control(F+E)Control (F+E) sgRNACRISPR Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488.
RFN_EGFP_47pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
RFN_EGFP_80pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
RFN_EGFP_81pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
RFN_EGFP_82pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
RFN_EGFP_83pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
RFN_EGFP_84pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908.
pJA54sqt-1(e1350) gRNA1 (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730.
AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR (AAV-KPL)sgRNA (Synthetic), Renilla luciferase, Cre recombinase, KrasG12D HDR donor (Mus musculus)Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.
AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITRsgRNA, Renilla luciferase, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.
AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITRsgRNA, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.
AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITRsgRNA, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.
AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITRsgRNA, Cre recombinase, EGFPMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014.
gRNA-eGFP-ReportergRNA (5'-AAAGGTCGAGAAACTGCAAA-3')Mammalian Expression, CRISPR Gersbach A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753.
pCASS. pyogenese Cas9 (Other), RNA pol III promoter (tRNA-Tyr) (Saccharomyces cerevisiae), hepatitis delta virus ribozyme, genomic (Other), sgRNA (Synthetic)Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology Cate Selection of chromosomal DNA libraries using a multiplex CRISPR system. Elife. 2014 Aug 19;3. doi: 10.7554/eLife.03703.
pLV-sgCDKN1B#2 BFPBFPMammalian Expression, Lentiviral, CRISPR Vale A Protein-Tagging System for Signal Amplification in Gene Expression and Fluorescence Imaging. Cell. 2014 Oct 8. pii: S0092-8674(14)01227-6. doi: 10.1016/j.cell.2014.09.039.
pT7-gRNA:Tyr (albino)Tyrosinase gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
pT7-gRNA:Tyr (wild)Tyrosinase gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
pT7-gRNA:AsipAgouti signaling protein gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
pT7-gRNA:kit-1v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
pT7-gRNA:kit-2-1v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
pT7-gRNA:kit-2-2v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240.
DR274-eGFP sgRNAEGFP sgRNA (Synthetic)CRISPR Del Bene Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Res. 2014 Jan;24(1):142-53. doi: 10.1101/gr.161638.113. Epub 2013 Oct 31.
gRNA-hIRF-1 #12gRNA_hIRF1 promoter #12 (Homo sapiens)Mammalian Expression, CRISPR Fujii Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Biochem Biophys Res Commun. 2013 Sep 13;439(1):132-6. doi: 10.1016/j.bbrc.2013.08.013. Epub 2013 Aug 11.
gRNA-hIRF-1 #12/pSIRgRNA_hIRF1 promoter #12 (Homo sapiens)Mammalian Expression, Retroviral, CRISPR Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014.
pJW1219sgRNA(F+E) (Synthetic)Worm Expression, CRISPR Ward Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Genetics. 2014 Dec 9. pii: genetics.114.172361.
pJW1285sgRNA(F+E) targeting pha-1 (Synthetic)Worm Expression, CRISPR Ward Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Genetics. 2014 Dec 9. pii: genetics.114.172361.
pMM178Cas9, tracrRNA, crRNA (Other)Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011.
pMM441Cas9, tracrRNA, crRNA (Other)Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011.
pRC319Cas9, tracrRNA, crRNA (Other)Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011.
px335 Mettl14 sgRNA #2gccgctcccggatctcctgc (Mus musculus)Mammalian Expression, CRISPR Hanna m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 1 January 2015
px335 Mettl14 sgRNA #1gcggcagctcctagctcagc (Mus musculus)Mammalian Expression, CRISPR Hanna m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 1 January 2015
px330-USP13USP13 (Homo sapiens)CRISPR Ye USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14.
px330-gp78gp78 (Homo sapiens)CRISPR Ye USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14.
MLM3636-Prnp-CDS-NegPrP guiding sequence (Mus musculus)Mammalian Expression, CRISPR Schmitt-Ulms CRISPR-Cas9-Based Knockout of the Prion Protein and Its Effect on the Proteome. PLoS One. 2014 Dec 9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014.
MLM3636-Prnp-CDS-PosPrP guiding sequence (Mus musculus)Mammalian Expression, CRISPR Schmitt-Ulms CRISPR-Cas9-Based Knockout of the Prion Protein and Its Effect on the Proteome. PLoS One. 2014 Dec 9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014.
pTargetFsgRNA (Synthetic)Bacterial Expression, CRISPR Yang Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14.
pAN-PBAD-sgRNA-A1NTA1NT (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A1TA1T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A2NTA2NT sgRNABacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A2TA2T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A3NTA3NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A3TA3T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A4NTA4NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A4TA4T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A5NTA5NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-A5TA5T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-scramblescramble sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-PBAD-sgRNA-VRVR sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-NORA2NT sgRNA (Synthetic), A2NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-ANDA1NT sgRNA (Synthetic), A4NT sgRNA (Synthetic), A2NT sgRNA (Synthetic), A1NT (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pAN-OR-MalT-3NTA2NT sgRNA (Synthetic), Malt-3NT sgRNA (Synthetic), A2NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735.
pJZC545sgRNA + 1x MS2 binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC583sgRNA + 2x MS2 binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC588sgRNA + 2x MS2 (wt+f6) binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC548sgRNA + 1x PP7Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC603sgRNA + 2x PP7 RNA binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC572sgRNA + 1x com RNA binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC593sgRNA + MS2-PP7 RNA binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC523sgRNAYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC625sgRNA +1x MS2, Pol II promoter with ribozyme cleavageYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC35sgRNAMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC32sgRNA, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC25sgRNA + 1x MS2 binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC33sgRNA + 2x MS2 binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC34sgRNA + 2x MS2(wt+f6) binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC41sgRNA, PCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC39sgRNA + 1x PP7, mCherryMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC40sgRNA + 2x PP7, mCherryMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC101sgRNA, COM-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC48sgRNA + 1x COM binding module, COM-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC102sgRNAMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC77sgRNA, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC78sgRNA + 1x COM binding module, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC103sgRNAMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC73sgRNA, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC74sgRNA + 1x COM binding module, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC116sgRNA + 2x MS2 (wt+f6) binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pKCcas9dOScocas9 (Other), sgRNA (), act-orf4 homology armBacterial Expression, CRISPR ; Bacterial Genome Editing Jiang One-step high-efficiency CRISPR/Cas9-mediated genome editing in Streptomyces. Acta Biochim Biophys Sin (Shanghai). 2015 Apr;47(4):231-43. doi: 10.1093/abbs/gmv007. Epub 2015 Mar 3.
ptreCas9-mKate2ps-T1gRNACas9–mKate2ps (Synthetic)Mammalian Expression Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18.
pCas9–mKate2ps–T1gRNACas9–mKate2ps (Synthetic)Mammalian Expression Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18.
pX330_sgACTA2ACTA2 (Homo sapiens)Mammalian Expression Qi Small Molecules Enhance CRISPR Genome Editing in Pluripotent Stem Cells. Cell Stem Cell. 2015 Feb 5;16(2):142-7. doi: 10.1016/j.stem.2015.01.003.
PX458_CEBPB_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_CEBPB_2gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_RAD21_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
Adeno EAU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9 (Mus musculus)Adenoviral Ventura In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014 Dec 18;516(7531):423-7. doi: 10.1038/nature13902. Epub 2014 Oct 22.
sgRNA1_ASCL1sgRNA1_ASCL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA2_ASCL1sgRNA1_ASCL2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA3_ASCL1sgRNA1_ASCL3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA4_ASCL1sgRNA1_ASCL4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA2_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA3_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA4_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_IL1RNIL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA2_IL1RNsgRNA2_IL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA3_IL1RNsgRNA3_IL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA4_IL1RNsgRNA4_IL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_NANOGsgRNA1_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA2_NANOGsgRNA2_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA3_NANOGsgRNA3_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA4_NANOGsgRNA4_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_GAL4UAS-Luciferase reportersgRNA1 for GAL4UAS-Luciferase reporter (Synthetic)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA2_GAL4UAS-Luciferase reportersgRNA2 for GAL4UAS-Luciferase reporter (Synthetic)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA3_GAL4UAS-Luciferase reportersgRNA3 for GAL4UAS-Luciferase reporter (Synthetic)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_pNeurog2-Luciferase reportersgRNA1 for pNeurog2-Luciferase reporter (Synthetic)Mammalian Expression, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
sgRNA1_Tet-inducible Luciferase reportersgRNA1 for Tet-inducible Luciferase reporter (Synthetic)Mammalian Expression, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22.
pU6-sgRosa26-1_CBh-Cas9-T2A-BFPCas9 (Other), sgRNA targeting ROSA26-1Mammalian Expression, CRISPR Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1BCas9 (Other), sgRNA targeting ROSA26-1Mammalian Expression, CRISPR Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198.
pU6a:sgRNA(tyr)U6a:sgRNA (tyr) (Danio rerio)CRISPR Chen Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 2015 Apr 8. pii: genetics.115.176917.
PX458_GABPA_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_GABPA_2gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
gRNA-ura-HYBgBlock product of ura3 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3.
gRNA-trp-HYBgBlock product of trp1 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3.
gRNA-leu-HYBgBlock product of leu2 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3.
gRNA-his-HYBgBlock product of his3 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3.
pRPR1_a1gRNA_RPR1ta1 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c1gRNA_RPR1tc1 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c2gRNA_RPR1tc2 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c3gRNA_RPR1tc3 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c4gRNA_RPR1tc4 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c5gRNA_RPR1tc5 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c6gRNA_RPR1tc6 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c7gRNA_RPR1tc7 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_c8gRNA_RPR1tc8 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_g1gRNA_RPR1tg1 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
pRPR1_g2gRNA_RPR1tg2 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11.
PX458_ATF1_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_CREB1_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_CREB1_2gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
pCas9–mKate2ps–CgRNACas9–mKate2psMammalian Expression Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18.
pT7-th-sgRNAth sgRNA (Danio rerio)in vitro RNA transcription Du Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system. Cell Res. 2015 Apr 7. doi: 10.1038/cr.2015.43.
pT7-gfap-sgRNAgfap sgRNA (Danio rerio)in vitro RNA transcription Du Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system. Cell Res. 2015 Apr 7. doi: 10.1038/cr.2015.43.
AP56-5sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP56-6sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP56-7sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP56-8sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP54-3sgRNA for APs12 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP54-5sgRNA for APs12 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
pIK208U6 promoter::dpy-10 sgRNA with a "flipped and extended" sgRNA backbone (Caenorhabditis elegans)Worm Expression, CRISPR Katic CRISPR/Cas9 Genome Editing in Caenorhabditis elegans: Evaluation of Templates for Homology-Mediated Repair and Knock-Ins by Homology-Independent DNA Repair. G3 (Bethesda). 2015 Jun 3. pii: g3.115.019273. doi: 10.1534/g3.115.019273.
APq5271sgRNA for APa4-2Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
APq5210sgRNA for APa4-2Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP303-3sgRNA for APs1Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP303-4sgRNA for APs1Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP332-2sgRNA for APs4Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP332-3sgRNA for APs4Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP332-4sgRNA for APs4Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP324-2sgRNA for APs6Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP324-3sgRNA for APs6Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP324-4sgRNA for APs6Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP334-2sgRNA for APs5Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP334-5sgRNA for APs5Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
AP334-6sgRNA for APs5Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
APCSD 53sgRNA for CSD 53Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
APCSD 54sgRNA for CSD 54Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23.
pJZC42sgRNA + 1XPP7, PCP-VP64 IRES mCherryMammalian Expression Lim Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pJZC43sgRNA + 2XPP7, PCP-VP64 IRES mCherryMammalian Expression Lim Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052.
pX330.iGFP1iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.iGFP2iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.iGFP3iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.iGFP5iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.LoxPOLSL-TomatoMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.LoxPLoxP sgRNAMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.Pten.aPten deletion (Mus musculus)Mammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
pX330.Pten.bPten deletion (Mus musculus)Mammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111.
Lenti-sgLkb1/CresgLkb1 (Mus musculus)Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR Winslow Pancreatic cancer modeling using retrograde viral vector delivery and in vivo CRISPR/Cas9-mediated somatic genome editing. Genes Dev. 2015 Jul 15;29(14):1576-85. doi: 10.1101/gad.264861.115. Epub 2015 Jul 15.
Lenti-sgNT/CresgNT (Mus musculus)Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR Winslow Pancreatic cancer modeling using retrograde viral vector delivery and in vivo CRISPR/Cas9-mediated somatic genome editing. Genes Dev. 2015 Jul 15;29(14):1576-85. doi: 10.1101/gad.264861.115. Epub 2015 Jul 15.
pCAS9-mCherry-TUBBgRNA TUBB Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.
pCAS9-mCherry-ACTG1gRNA ACTG1 (Homo sapiens) Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.
pCAS9-mCherry-HIST1H4CgRNA HIST1H4C (Homo sapiens) Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338.
Oct4-Cr1gRNA for Crispr targeting the OCT4 stop codon (Homo sapiens)Mammalian Expression Huangfu A CRISPR/Cas-Mediated Selection-free Knockin Strategy in Human Embryonic Stem Cells. Stem Cell Reports. 2015 May 28. pii: S2213-6711(15)00128-9. doi: 10.1016/j.stemcr.2015.04.016.
Lenti-sgNeo/CresgNeo (Mus musculus)Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR Winslow Pancreatic cancer modeling using retrograde viral vector delivery and in vivo CRISPR/Cas9-mediated somatic genome editing. Genes Dev. 2015 Jul 15;29(14):1576-85. doi: 10.1101/gad.264861.115. Epub 2015 Jul 15.
pKLV2-U6gRNA5(gBFP)-PGKGFP2ABFP-WU6gRNA cassette, PGKGFP2ABFP cassette, WPRE (Homo sapiens), Guide RNA targeting modified BFPLentiviral, CRISPR Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079.
pKLV2-U6gRNA5(gBFP)-PGKmCherry2ABFP-WU6gRNA cassette, PGKmCherryABFP cassette, WPRE (Homo sapiens), Guide RNA targeting modified BFP (Synthetic)Lentiviral, CRISPR Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079.
p426-SNR52p-gRNA.csr-1.Y-SUP4tgRNA for csr-1 locus (Other)Yeast Expression, CRISPR ; N. crassa, Fungi Hong Efficient gene editing in Neurospora crassa with CRISPR technology Fungal Biology and Biotechnology 2015, 2:4
pICSL11057Promote:TaU6+sgRNA HvPM19_1 (Other)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7.
pICSL11058Promoter_TaU6 + sgRNA_HvPM19_3 (Other)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7.
pICSL11061Promoter_AtU6-26 + sgRNA_BolC.GA4a-1 (Arabidopsis thaliana)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7.
pICSL11062Promoter_AtU6-26 + sgRNA_BolC.GA4a-2 (Arabidopsis thaliana)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7.
pU6_(GLuc)_sgRNAGluc sgRNA (Synthetic)Mammalian Expression, CRISPR Rinn Multiplexable, locus-specific targeting of long RNAs with CRISPR-Display. Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1.
PAX6 sgRNA2sgRNA targeting PAX6 (Homo sapiens)Mammalian Expression, CRISPR Zhang Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001.
PAX6 sgRNA7sgRNA targeting PAX6 (Homo sapiens)Mammalian Expression, CRISPR Zhang Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001.
pX330-sgRNA_Dicer_1sgRNA mouse Dicer1 (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb.
pX330-sgRNA_Dicer_2sgRNA mouse Dicer1 (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb.
pX330-sgRNA_Dicer_3sgRNA mouse Dicer1 (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb.
pMM704dCas9, LacI, sgRNA Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015
pMM705dCas9, LacI, sgRNA Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015
pMM710dCas9, LacI, sgRNA Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015
pMM725dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015
pMM731dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015
pMM732dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015
pMM733dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015
pMM750dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015
pMM763dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015
pMM764dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015
pLKO1-puro-U6-sgRNA-TS2TS2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-TS3TS3 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-TS4TS4 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-LRTM2LRTM2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-KANK3KANK3 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-TGM2TGM2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
pLKO1-puro-U6-sgRNA-PLXNB2PLXNB2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624.
GG-EBNA-OCT45 concatenated gRNA transcriptional cassettes targeting OCT4CRISPR Otonkoski Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation. Stem Cell Reports. 2015 Sep 8;5(3):448-59. doi: 10.1016/j.stemcr.2015.08.001.
HPRT2b-pGEMHPRT gRNA2 (Homo sapiens)Mammalian Expression Yan Enriching CRISPR-Cas9 targeted cells by co-targeting the HPRT gene. Nucleic Acids Res. 2015 Jun 29. pii: gkv675.
pX330-mitfmitf-sgRNA (Other), SpCas9 (Synthetic)Mammalian Expression Zhao Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs. Sci Rep. 2015 Aug 21;5:13348. doi: 10.1038/srep13348.
CRISPRmTmG2gRNA that targets near LoxP sites Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21.
pTC217Nuclease (Cas9/sgRNA) + Donor + GVR (Other)Plant Expression, CRISPR Voytas High-frequency, precise modification of the tomato genome. Genome Biol. 2015 Nov 6;16(1):232. doi: 10.1186/s13059-015-0796-9.
pTC223Nuclease (Cas9/sgRNA) + Donor + GVR (Other)Plant Expression, CRISPR Voytas High-frequency, precise modification of the tomato genome. Genome Biol. 2015 Nov 6;16(1):232. doi: 10.1186/s13059-015-0796-9.
AP568-2sgRNA for dpy‐10Worm Expression, CRISPR Seydoux High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 2015 Sep;201(1):47-54. doi: 10.1534/genetics.115.179382. Epub 2015 Jul 17.
AP568-3sgRNA for dpy‐10Worm Expression, CRISPR Seydoux High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 2015 Sep;201(1):47-54. doi: 10.1534/genetics.115.179382. Epub 2015 Jul 17.
lentiCRISPR - C16orf80 sgRNA 2sgRNA against C16orf80Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - C16orf80 sgRNA 1sgRNA against C16orf80Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - C3orf17 sgRNA 1sgRNA against C3orf17Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - C3orf17 sgRNA 2sgRNA against C3orf17Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - C9orf114 sgRNA 2sgRNA against C9orf114Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - C9orf114 sgRNA 1 sgRNA against C9orf114Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - DDX3Y sgRNA 1sgRNA against DDX3YMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - DDX3Y sgRNA 2sgRNA against DDX3YMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - Amplicon, BCR/ABL sgRNA 2sgRNA against BCR/ABLamplicon found in CML-derived K562 cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - Amplicon, BCR/ABL sgRNA 1sgRNA against BCR/ABLamplicon found in CML-derived K562 cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - Amplicon, JAK2 sgRNA 2sgRNA against JAK2 amplicon found in AML-derived HEL cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - AAVS1 sgRNAsgRNA against AAVS1Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - CTRL sgRNAnon-targeting sgRNAMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
lentiCRISPR - Amplicon, JAK2 sgRNA 1 sgRNA against JAK2 amplicon found in AML-derived HEL cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041.
pHEE2E-TRIsgRNA targeting TRY and CPC genes (Synthetic), sgRNA targeting ETC2 gene (Synthetic), zCas9 (Other)Plant Expression, CRISPR ; Plant binary vector Chen Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0.
pRB1081dpy-10 gRNA (Synthetic)Worm Expression, CRISPR Fire Cas9 Variants Expand the Target Repertoire in Caenorhabditis elegans. Genetics. 2015 Dec 17. pii: genetics.115.185041.
sgPal1 (p2Tol-U6-sgPal1-HygR)sgPal1 Sherwood Cloning-free CRISPR. Stem Cell Reports. 2015 Oct 27. pii: S2213-6711(15)00284-2. doi: 10.1016/j.stemcr.2015.09.022.
sgPal7 (p2Tol-U6-sgPal7-HygR)sgPal7 Sherwood Cloning-free CRISPR. Stem Cell Reports. 2015 Oct 27. pii: S2213-6711(15)00284-2. doi: 10.1016/j.stemcr.2015.09.022.
pRB1084dpy-10 gRNA (Synthetic)Worm Expression, CRISPR Fire Cas9 Variants Expand the Target Repertoire in Caenorhabditis elegans. Genetics. 2015 Dec 17. pii: genetics.115.185041.
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8BACH2-sgRNA8 (Homo sapiens)Mammalian Expression, CRISPR Zoldoš Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Res. 2016 Mar 11. pii: gkw159.
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8 (ANV)BACH2-sgRNA8 (Homo sapiens)Mammalian Expression, CRISPR Zoldoš Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Res. 2016 Mar 11. pii: gkw159.
pdCas9-DNMT3A-PuroR_hNTNon-targeting sgRNA human (Homo sapiens)Mammalian Expression, CRISPR Zoldoš Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Res. 2016 Mar 11. pii: gkw159.
pDECKO_GFPgRNAs toward GFP (Synthetic)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_Malat1_AgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_Malat1_BgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_Malat1_CgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_Malat1_DgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_Malat1_EgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_TFRC_BgRNAs toward TFRC (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_TFRC_C (with mCherry)gRNAs toward TFRC (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
pDECKO_UCA1gRNAs toward UCA1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z.
AAVS1 T2 CRIPR in pX330Cas9 and gRNA for targeting the AAVS1 locus in human cells (Homo sapiens)Mammalian Expression, CRISPR Kanemaki Rapid Protein Depletion in Human Cells by Auxin-Inducible Degron Tagging with Short Homology Donors. Cell Rep. 2016 Apr 5;15(1):210-8. doi: 10.1016/j.celrep.2016.03.001. Epub 2016 Mar 24.
pT7-gRNA_zebrafish_mmp21zebrafish mmp21 (Danio rerio)CRISPR Katsanis A human laterality disorder caused by a homozygous deleterious mutation in MMP21. J Med Genet. 2015 Dec;52(12):840-7. doi: 10.1136/jmedgenet-2015-103336. Epub 2015 Oct 1.
pMD19T-slr0230-PL31-sgRNANT1-KmRPL31-sgRNA NT1Bacterial Expression Hudson Multiple Gene Repression in Cyanobacteria Using CRISPRi. ACS Synth Biol. 2015 Dec 28.
pMD19T-slr0230-PL22-sgRNANT1-KmRPL22-sgRNA NT1Bacterial Expression Hudson Multiple Gene Repression in Cyanobacteria Using CRISPRi. ACS Synth Biol. 2015 Dec 28.
pNICKclos2.0Cas9 nickase (Other), sgRNA to xylR (Synthetic)E.coli - clostridium shuttle vector Yang CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053.
pCfB3020(gRNA X-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3041(gRNA X-3)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3042(gRNA X-4)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3043(gRNA XI-1)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3044(gRNA XI-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3045(gRNA XI-3)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3046(gRNA XI-5)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3047(gRNA XII-1)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3048(gRNA XII-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3049(gRNA XII-4)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3050(gRNA XII-5)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3051(gRNA X-3 XI-2 XII-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3052(gRNA X-4, XI-3, XII-5)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pCfB3053(gRNA X-2, XI-5, XII-4)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23.
pdCas9-M-C4Repressor C4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-3F2Repressor C4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-3H5Repressor 3H5 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-1B6Repressor 1B6 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-4F2Repressor 4F2 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-5F5Repressor 5F5 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-1D4Repressor 1D4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-4A6Repressor 4A6 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-3A2Repressor 3A2 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-1E4Repressor 1E4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pdCas9-M-G6Repressor G6 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231.
pX330-sgRNA_Dgcr8_1DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pX330-sgRNA_Dgcr8_2DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pX330-sgRNA_Dgcr8_3DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pX330-sgRNA_Dgcr8_4DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pX330-sgRNA_Ago2_1AGO2 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX330-sgRNA_Ago2_2AGO2 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago2_3AGO2 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago2_4AGO2 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago1_1AGO1 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago1_2AGO1 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago1_3AGO1 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pX458-sgRNA_Ago1_4AGO1 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Argonaute 2 Is Required for Extra-embryonic Endoderm Differentiation of Mouse Embryonic Stem Cells. Stem Cell Reports. 2018 Jan 24. pii: S2213-6711(17)30571-4. doi: 10.1016/j.stemcr.2017.12.023.
pNICKclos1.0Cas9 nickase (Other), sGRNA to pyrEE.coli-clostridium shuttle vector Yang CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053.
pdCASclosdCas9 (Other), sgRNA to spo0AE.coli-clostridium shuttle vector Yang CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053.
B51gRNA (Mus musculus)CRISPR Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21.
B53gRNA (Mus musculus)CRISPR Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21.
B31gRNA (Mus musculus)CRISPR Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21.
B33gRNA (Mus musculus)CRISPR Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21.
pAL-pgi_TsgRNA pgi (T)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-pgi_NTsgRNA pgi (NT) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-pck_TsgRNA pck (T) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-pck_NTsgRNA pck (NT) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-pyk_TsgRNA pyk (T) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-pyk_NTsgRNA pyk (NT) (Synthetic)Bacterial Expression, CRISPR Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pAL-rfp_TsgRNA rfp (T) (Synthetic)Bacterial Expression, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16.
pLCKO_LacZ_sgRNALacZ sgRNA (Other)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_PSMD1_sgRNA_1PSMD1 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_PSMD1_sgRNA_5PSMD1 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_PSMB2_sgRNA_1PSMB2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_PSMB2_sgRNA_5PSMB2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_EIF3D_sgRNA_1EIF3D sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_EIF3D_sgRNA_4EIF3D sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pLCKO_Luciferase_sgRNALuciferase sgRNA (Other)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25.
pMOD8A-iRGR-r11RGR-r11 (Synthetic)Yeast Expression, CRISPR, Synthetic Biology Klavins Robust digital logic circuits in eukaryotic cells with CRISPR/dCas9 NOR gates bioRxiv 041871
pMOD8A-RGR-r10RGR-r10 (Synthetic)Yeast Expression, CRISPR, Synthetic Biology Klavins Robust digital logic circuits in eukaryotic cells with CRISPR/dCas9 NOR gates bioRxiv 041871
pX462-hPRKAA1-gRNA_Ahuman AMPK alpha 1 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138.
pX462-hPRKAA1-gRNA_Bhuman AMPK alpha 1 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138.
pX462-hPRKAA2-gRNA_Ahuman AMPK alpha 2 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138.
pX462-hPRKAA2-gRNA_Bhuman AMPK alpha 2 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138.
pBluescriptSKII+ U6-sgRNA(F+E) ACTBU6 promoter driving sgRNA targeting the 3'UTR of ACTB mRNAMammalian Expression, CRISPR Yeo Programmable RNA Tracking in Live Cells with CRISPR/Cas9. Cell. 2016 Mar 16. pii: S0092-8674(16)30204-5. doi: 10.1016/j.cell.2016.02.054.
pBluescriptSKII+ U6-sgRNA(F+E) TFRCU6 promoter driving sgRNA targeting the 3'UTR of TFRC mRNAMammalian Expression, CRISPR Yeo Programmable RNA Tracking in Live Cells with CRISPR/Cas9. Cell. 2016 Mar 16. pii: S0092-8674(16)30204-5. doi: 10.1016/j.cell.2016.02.054.
pLC-EGFP-RIP1RIPK1 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.
pLC-RFP657-CASP8CASP8 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.
pLC-EGFP-RIP3RIP3 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.
pLC-BFP-FADDFADD sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.
pLC-mCherry-MLKLMLKL sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986.
NFATc2-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc2-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc2-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc2-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc1-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc1-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc1-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
NFATc1-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Ikaros-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Ikaros-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Ikaros-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Ikaros-CRISPR-Nick2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Helios-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against human Helios (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Helios-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Helios (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
Helios-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Helios (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326.
pLH-sgRNA1sgRNA1 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-2XMS2sgRNA1-2XMS2 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-2XPP7sgRNA1-2XPP7 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-2XboxBsgRNA1-2XboxB (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-MS2-PP7sgRNA1-2XMS2-PP7 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-PP7-boxBsgRNA1-2XPP7-boxB (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-boxB-MS2sgRNA1-boxB-MS2 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
pLH-sgRNA1-boxB-MS2-PP7sgRNA1-boxB-MS2-PP7 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
sgTP53_3TP53 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Hahn Integrated genetic and pharmacologic interrogation of rare cancers. NATURE COMMUNICATIONS 7:11987
sgGFP_3GFPMammalian Expression, Lentiviral, CRISPR Hahn Integrated genetic and pharmacologic interrogation of rare cancers. NATURE COMMUNICATIONS 7:11987
USP19 sgRNA1USP19 sgRNA1 (Homo sapiens)Mammalian Expression, CRISPR Ye Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13.
USP19 sgRNA2USP19 sgRNA2 (Homo sapiens)Mammalian Expression, CRISPR Ye Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13.
pZac2.1 U6-SaDMDR7-U6-SaDMDL2U6-SaDMDR7-U6-SaDMDL2 (Synthetic)Mammalian Expression, AAV, CRISPR Wagers In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31.
pZac2.1 U6-SaAi9L-U6-SaAi9RgRNAs for SaCas9 targeting Ai9 locus (Synthetic)Mammalian Expression, AAV, CRISPR Wagers In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31.
pZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2 (Synthetic)Mammalian Expression, AAV, CRISPR Wagers In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31.
pZac2.1 EFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2EFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2 (Synthetic)Mammalian Expression, AAV, CRISPR Wagers In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31.
pCRII-Topo U6-SpAi9L-U6SpDMDLU6-SpAi9L-U6SpDMDL (Synthetic)Mammalian Expression, CRISPR Wagers In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31.
pCRII-Topo U6-SpAi9R-U6-SpDMDRU6-SpAi9R-U6-SpDMDR (Synthetic)Unspecified Wagers In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31.
pX330_HR_Prnp_3pX330_HR_Prnp_3 (Mus musculus)Mammalian Expression, Mouse Targeting, CRISPR Jackson Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016.
pX335_HR_Prnp_3HR_Prnp_3 (Mus musculus)Mammalian Expression, Mouse Targeting, CRISPR Jackson Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016.
pX459_HR_Prnp_3HR_Prnp_3 (Mus musculus)Mammalian Expression, Mouse Targeting, CRISPR Jackson Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016.
sgRNA(MS2)_Prnp_SAM1sgRNA(MS2)_Prnp_SAM1 (Mus musculus)Mammalian Expression, CRISPR Jackson Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016.
sgRNA(MS2)_Prnp_SAM2sgRNA(MS2)_Prnp_SAM2 (Mus musculus)Mammalian Expression, CRISPR Jackson Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016.
Cas9-GFP_sg_mAMPKa1Prkaa1 (Mus musculus)Mammalian Expression, CRISPR Shaw AMPK governs lineage specification through Tfeb-dependent regulation of lysosomes. Genes Dev. 2016 Mar 1;30(5):535-52. doi: 10.1101/gad.274142.115.
Cas9-GFP_sg_mAMPKa2Prkaa2 (Mus musculus)Mammalian Expression, CRISPR Shaw AMPK governs lineage specification through Tfeb-dependent regulation of lysosomes. Genes Dev. 2016 Mar 1;30(5):535-52. doi: 10.1101/gad.274142.115.
Cas9-GFP_sg_mTfebsgTfeb (Mus musculus)Mammalian Expression, CRISPR Shaw AMPK governs lineage specification through Tfeb-dependent regulation of lysosomes. Genes Dev. 2016 Mar 1;30(5):535-52. doi: 10.1101/gad.274142.115.
pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA(HPRT)SpCas9 (Other)Mammalian Expression Kondo Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science. 2016 Aug 4. pii: aaf8729.
pcDNA3.1_pCMV-dCas-PmCDA1 pH1-gRNA(HPRT)SpCas9 (Other)Mammalian Expression Kondo Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science. 2016 Aug 4. pii: aaf8729.
pX330-sgRNA_Drosha_1sgRNA Drosha (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pX330-sgRNA_Drosha_2sgRNA Drosha (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pX330-sgRNA_Drosha_3sgRNA Drosha (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pX330-sgRNA_Drosha_4sgRNA Drosha (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073.
pJMP2sgRNA RR1 (Other)Bacterial Expression, CRISPR Gross A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26.
pJMP3sgRNA RR1 (Other)Bacterial Expression, CRISPR Gross A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26.
eSpCas9(1.1)_No_FLAG_AAVS1_T2Mammalian Expression, CRISPR Doyon A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells. Cell Rep. 2015 Oct 7. pii: S2211-1247(15)01020-7. doi: 10.1016/j.celrep.2015.09.009.
SP_gRNA_pUC19_N_FancF_LeftFancF_Site_1_Left (Homo sapiens)CRISPR Doyon A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells. Cell Rep. 2015 Oct 7. pii: S2211-1247(15)01020-7. doi: 10.1016/j.celrep.2015.09.009.
pX330-COSMC-KOCOSMC (Homo sapiens)CRISPR Neelamegham Using CRISPR-Cas9 to quantify the contributions of O-glycans, N-glycans and Glycosphingolipids to human leukocyte-endothelium adhesion. Sci Rep. 2016 Jul 26;6:30392. doi: 10.1038/srep30392.
pX330-MGAT1-KOMGAT1 (Homo sapiens)CRISPR Neelamegham Using CRISPR-Cas9 to quantify the contributions of O-glycans, N-glycans and Glycosphingolipids to human leukocyte-endothelium adhesion. Sci Rep. 2016 Jul 26;6:30392. doi: 10.1038/srep30392.
pX330-UGCG-KOUGCG (Homo sapiens)CRISPR Neelamegham Using CRISPR-Cas9 to quantify the contributions of O-glycans, N-glycans and Glycosphingolipids to human leukocyte-endothelium adhesion. Sci Rep. 2016 Jul 26;6:30392. doi: 10.1038/srep30392.
pU6-SAG1-DHFRSAG1 sgRNACRISPR Lourido A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2.
pU6-DecoyDecoy sgRNACRISPR Lourido A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2.
pmCherry_gRNAsp Cas9 gRNA (Other), mCherry (Other)Mammalian Expression, CRISPR Welker crispr/cas9 (unpublished)
pXAT2AAVS1 sgRNA-T2 (Homo sapiens)Mammalian Expression, CRISPR Woltjen Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Methods. 2015 Dec 18. pii: S1046-2023(15)30181-X. doi: 10.1016/j.ymeth.2015.12.012.
peSpCas9(1.1)-2×sgRNA (IFT88, donor)IFT88 gRNA#1 (Homo sapiens)Mammalian Expression, CRISPR Nakayama Practical method for targeted disruption of cilia-related genes by using CRISPR/Cas9-mediated homology-independent knock-in system. Mol Biol Cell. 2017 Feb 8. pii: mbc.E17-01-0051. doi: 10.1091/mbc.E17-01-0051.
pAAV-SMVP-Cas9N-U6-gRNA M3Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.
pAAV-SMVP-Cas9N-U6-gRNA M4Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.
pAAV-SMVP-Cas9N-U6-gRNA TdLCas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.
pAAV-SMVP-Cas9N-U6-gRNA TdRCas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.
pAAV-SMVP-Cas9N-U6-gRNA P1Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.
pAAV-SMVP-Cas9N-U6-gRNA P2Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993.
pHu6-gRNA-NT1hU6 expression of gRNA NT1 (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_gRNA_Ch10-rev2hU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_gRNA_Ch10-rev1hU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_gRNA_Ch10-for2hU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_gRNA_Ch10-for1hU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_Ch5_155183064-gRNA-forhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_Ch5_155183064-gRNA-revhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_Ch12_62418577-gRNA-forhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_Ch12_62418577-gRNA-revhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_Ch13_102010574-gRNA-forhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_Ch13_102010574-gRNA-revhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_chr12_FAM19A2-up-gRNA-revhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_chr12_FAM19A2-up-gRNA-forhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_chr12_FAM19A2-down-gRNA-revhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
pHU6_chr12_FAM19A2-down-gRNA-forhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707.
TU#1805_CRISPR_unc-73_exon2Cas9 and sgRNA against unc-73 exon2 (Caenorhabditis elegans)Worm Expression, CRISPR Chalfie GEFs and Rac GTPases control directional specificity of neurite extension along the anterior-posterior axis. Proc Natl Acad Sci U S A. 2016 Jun 21;113(25):6973-8. doi: 10.1073/pnas.1607179113. Epub 2016 Jun 6.
TU#1806_CRISPR_unc-73_exon21Cas9 and sgRNA against unc-73 exon21 (Caenorhabditis elegans)Worm Expression, CRISPR Chalfie GEFs and Rac GTPases control directional specificity of neurite extension along the anterior-posterior axis. Proc Natl Acad Sci U S A. 2016 Jun 21;113(25):6973-8. doi: 10.1073/pnas.1607179113. Epub 2016 Jun 6.
pCas5gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas13gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas14gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas15gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas27gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas28gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas34gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas35gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas36gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas39gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas45gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas52gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas55gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas56gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas57gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
pCas59gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007.
p184_LTJ_sgRNACD90.2sgRNA targeting mouse CD90.2 (Mus musculus)Mammalian Expression, CRISPR Jeker Highly Efficient and Versatile Plasmid-Based Gene Editing in Primary T Cells. J Immunol. 2018 Feb 14. pii: jimmunol.1701121. doi: 10.4049/jimmunol.1701121.
p183_LTJ_sgRNACD90.2_AsgRNA targeting CD90.2 (Mus musculus)Mammalian Expression, CRISPR Jeker Highly Efficient and Versatile Plasmid-Based Gene Editing in Primary T Cells. J Immunol. 2018 Feb 14. pii: jimmunol.1701121. doi: 10.4049/jimmunol.1701121.
p202_LTJ_sgRNACD45.2_R1sgRNA targeting mouse CD45.2 region 1 (Mus musculus)Mammalian Expression, CRISPR Jeker Highly Efficient and Versatile Plasmid-Based Gene Editing in Primary T Cells. J Immunol. 2018 Feb 14. pii: jimmunol.1701121. doi: 10.4049/jimmunol.1701121.
p204_LTJ_sgRNACD45.2_R2sgRNA targeting CD45.2 region 2 (Mus musculus)Mammalian Expression, CRISPR Jeker Highly Efficient and Versatile Plasmid-Based Gene Editing in Primary T Cells. J Immunol. 2018 Feb 14. pii: jimmunol.1701121. doi: 10.4049/jimmunol.1701121.
p206_LTJ_sgRNACD45.2_R3sgRNA targeting CD45.2 region 3 (Mus musculus)Mammalian Expression, CRISPR Jeker Highly Efficient and Versatile Plasmid-Based Gene Editing in Primary T Cells. J Immunol. 2018 Feb 14. pii: jimmunol.1701121. doi: 10.4049/jimmunol.1701121.
p240_LTJ_sgRNAFoxp3K276XsgRNA targeting Foxp3 K276X (Mus musculus)Mammalian Expression, CRISPR Jeker Highly Efficient and Versatile Plasmid-Based Gene Editing in Primary T Cells. J Immunol. 2018 Feb 14. pii: jimmunol.1701121. doi: 10.4049/jimmunol.1701121.
p236_LTJ_sgRNAFoxp3sf/JsgRNA targeting Foxp3 sf/J (Mus musculus)Mammalian Expression, CRISPR Jeker Highly Efficient and Versatile Plasmid-Based Gene Editing in Primary T Cells. J Immunol. 2018 Feb 14. pii: jimmunol.1701121. doi: 10.4049/jimmunol.1701121.
p163_LTJ_sgRNACD90.1sgRNA targeting mouse CD90.1 (Mus musculus)Mammalian Expression, CRISPR Jeker Highly Efficient and Versatile Plasmid-Based Gene Editing in Primary T Cells. J Immunol. 2018 Feb 14. pii: jimmunol.1701121. doi: 10.4049/jimmunol.1701121.
pJEP15-AAV-H1/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pAH1/TO gRNA Expression Cassette Containing Tet2 gRNAMammalian Expression, AAV, CRISPR Ploski The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing. Front Mol Neurosci. 2016 Aug 18;9:70. doi: 10.3389/fnmol.2016.00070. eCollection 2016.
pJEP13-AAV-H1/TO-L-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pAH1/TO-L gRNA Expression Cassette Containing Tet2 gRNAMammalian Expression, AAV, CRISPR Ploski The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing. Front Mol Neurosci. 2016 Aug 18;9:70. doi: 10.3389/fnmol.2016.00070. eCollection 2016.
pJEP11-AAV-U6/TO-sgRNA(Tet2)-CMV-TetR-P2A-eGFP-KASH-pAU6/TO gRNA Expression Cassette Containing Tet2 gRNAMammalian Expression, AAV, CRISPR Ploski The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing. Front Mol Neurosci. 2016 Aug 18;9:70. doi: 10.3389/fnmol.2016.00070. eCollection 2016.
T-STOP sgRNA-1T-STOP sgRNA (Homo sapiens)Mammalian Expression Thomson Single-cell RNA-seq reveals novel regulators of human embryonic stem cell differentiation to definitive endoderm. Genome Biol. 2016 Aug 17;17(1):173. doi: 10.1186/s13059-016-1033-x.
pCFD3-ebonyebony (Drosophila melanogaster)Insect Expression, CRISPR Padgett Efficient Screening of CRISPR/Cas9-Induced Events in Drosophila Using a Co-CRISPR Strategy. G3 (Bethesda). 2017 Jan 5;7(1):87-93. doi: 10.1534/g3.116.036723.
Sg-ASgRNACRISPR Feng Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. Nucleic Acids Res. 2016 May 19;44(9):e85. doi: 10.1093/nar/gkw064. Epub 2016 Feb 4.
sgRNA 1 GAPDHSgRNACRISPR Feng Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. Nucleic Acids Res. 2016 May 19;44(9):e85. doi: 10.1093/nar/gkw064. Epub 2016 Feb 4.
sgRNA 2 GAPDHSgRNACRISPR Feng Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. Nucleic Acids Res. 2016 May 19;44(9):e85. doi: 10.1093/nar/gkw064. Epub 2016 Feb 4.
pCfB2311 (SNR52p-gRNA.ADE2-SUP4t_natMX)gRNA targeting ADE2 gene (Saccharomyces cerevisiae)Yeast Expression Borodina CRISPR–Cas system enables fast and simple genome editing of industrial Saccharomyces cerevisiae strains Metab Eng Commun 2015
pLenti-L3US2-RFP-HDAC3HDAC3 dual gRNAs (Homo sapiens)Mammalian Expression, Lentiviral Chen Chen lab CRISPR plasmids (unpublished)
pCFD4d-U6-1:white1-U6-3:white1white sgRNA-1 (Drosophila melanogaster), white sgRNA-1 (Drosophila melanogaster)CRISPR Zamore Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Co-conversion. G3 (Bethesda). 2016 Aug 26. pii: g3.116.032557. doi: 10.1534/g3.116.032557.
pUC57-white[coffee]A 2,080 bp fragment of the white[coffee] allele (Drosophila melanogaster)Unspecified Zamore Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Co-conversion. G3 (Bethesda). 2016 Aug 26. pii: g3.116.032557. doi: 10.1534/g3.116.032557.
pSLQ1870-1 pHR: U6-SpsgTRE3G CMV-mCherrySp sgTRE3G (Synthetic)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.
pSLQ1869-1 pHR: U6-SpsgSV40 CMV-mCherrySp sgSV40 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.
pSLQ2806-2 pHR: U6-Sasgv2TRE3G CMV-mCherrySa sgTRE3G (Synthetic)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.
pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFPSp sgCD95-1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.
pSLQ1852-3 pHR: U6-SpsgCD95-2 CMV-EGFPSp sgCD95-2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.
pSLQ1852-5 pHR: U6-SpsgCD95-3 CMV-EGFPSp sgCD95-3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.
pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFPSa sgCXCR4-1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.
pSLQ2853-4 pHR: U6-Sasgv2CXCR4-2 CMV-EGFPSa sgCXCR4-2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.
pSLQ2853-5 pHR: U6-Sasgv2CXCR4-3 CMV-EGFPSa sgCXCR4-3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.
pSLQ2804 pHR: U6-SpsgTRE3G CMV-PYL1-VPR-IRES-mCherrySp sgTRE3G (Synthetic), PYL1-VPR (Arabidopsis thaliana)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.
pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherrySp sgSV40 (Synthetic), PYL1-KRAB (Arabidopsis thaliana)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042.
pSPneogRNA241510+MTLdBPK_241510.1 targeting gRNA and LdMT targeting gRNA (Other)CRISPR ; Leishmania donovani Matlashewski Optimized CRISPR-Cas9 Genome Editing for Leishmania and Its Use To Target a Multigene Family, Induce Chromosomal Translocation, and Study DNA Break Repair Mechanisms. mSphere. 2017 Jan 18;2(1). pii: e00340-16. doi: 10.1128/mSphere.00340-16. eCollection 2017 Jan-Feb.
mCBFKOgRNA2Cbfa2t2-gRNA2 (Mus musculus)Mammalian Expression, CRISPR Reinberg Co-repressor CBFA2T2 regulates pluripotency and germline development. Nature. 2016 Jun 8;534(7607):387-90. doi: 10.1038/nature18004.
mCBFKOgRNA5Cbfa2t2-gRNA5 (Mus musculus)Mammalian Expression, CRISPR Reinberg Co-repressor CBFA2T2 regulates pluripotency and germline development. Nature. 2016 Jun 8;534(7607):387-90. doi: 10.1038/nature18004.
mCm7RNA6ACbfa2t2 m7-gRNA6 (Mus musculus)Mammalian Expression, CRISPR Reinberg Co-repressor CBFA2T2 regulates pluripotency and germline development. Nature. 2016 Jun 8;534(7607):387-90. doi: 10.1038/nature18004.
B2M Bulldozer (gRNA crB2M_13)B2M Bulldozer crB2M_13 gRNA (Homo sapiens)Mammalian Expression Cowan Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell Stem Cell. 2014 Nov 6;15(5):643-52. doi: 10.1016/j.stem.2014.10.004. Epub 2014 Nov 6.
gRNA-mCtnnb1mCtnnb1 gRNA (Synthetic)CRISPR Koo One-step generation of conditional and reversible gene knockouts. Nat Methods. 2017 Jan 30. doi: 10.1038/nmeth.4156.
pCRISPRyl_AXPCas9Yeast Expression, CRISPR, Synthetic Biology Wheeldon Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19.
pCRISPRyl_XPR2Cas9Yeast Expression, CRISPR, Synthetic Biology Wheeldon Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19.
pCRISPRyl_A08Cas9Yeast Expression, CRISPR, Synthetic Biology Wheeldon Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19.
pCRISPRyl_D17Cas9Yeast Expression, CRISPR, Synthetic Biology Wheeldon Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19.
pCRISPRyl_MFE1Cas9Yeast Expression, CRISPR, Synthetic Biology Wheeldon Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19.
pEX-A-U6-MaSgRNA_PuroRmajor satellite-specific sgRNA (Other)Mammalian Expression, Bacterial Expression, CRISPR Leonhardt Determination of Local Chromatin Composition by CasID. Nucleus. 2016 Sep 27:0.
pEX-A-U6-MiSgRNA_PuroRminor satellite-specific sgRNAMammalian Expression, Bacterial Expression, CRISPR Leonhardt Determination of Local Chromatin Composition by CasID. Nucleus. 2016 Sep 27:0.
pEX-A-U6-TelgRNA_PuroRtelomere-specific sgRNAMammalian Expression, Bacterial Expression, CRISPR Leonhardt Determination of Local Chromatin Composition by CasID. Nucleus. 2016 Sep 27:0.
LCV2 V-1gRNA targeting VEGF-A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Yiu Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296.
LCV2 V-2gRNA targeting VEGF-A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Yiu Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296.
LCV2 V-3gRNA targeting VEGF-A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Yiu Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296.
LCV2 V-4gRNA targeting VEGF-A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Yiu Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296.
LCV2 V-5gRNA targeting VEGF-A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Yiu Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296.
FgH1tUTG_huMcl-1.1hu Mcl-1.1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26.
FgH1tUTG_huMcl-1.2hu Mcl-1.2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26.
FgH1tUTG_huBim_Ex3hu Bim (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26.
FgH1tUTG_muBim_Ex3mu Bim (Mus musculus) Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26.
FgH1tUTG_mup53_Ex4mu p53 (Mus musculus) Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26.
FgH1tUTG_mup53_Ex5mu p53 (Mus musculus)Mammalian Expression, Lentiviral, CRISPR Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26.
pJYS3_ΔcrtYfCpf1 (Other), crRNA of crtYf (Synthetic)Bacterial Expression, CRISPR ; Shuttle vector Corynebacterium glutamicum / E. coli Yang CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179.
pJYS2cm_crtYfcrRNA of crtYf (Synthetic)Bacterial Expression, CRISPR ; Shuttle vector Corynebacterium glutamicum / E. coli Yang CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179.
pJYS2_crtYfcrRNA of crtYf (Synthetic)Bacterial Expression, CRISPR ; Shuttle vector Corynebacterium glutamicum / E. coli Yang CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179.
sgAPC(A)APC, WNT signaling pathway regulator (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgAPC(B)APC, WNT signaling pathway regulator (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgTP53(A)tumor protein p53 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgTP53(B)tumor protein p53 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgTP53(R273)tumor protein p53 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgALK(A)anaplastic lymphoma receptor tyrosine kinase (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgALK(B)anaplastic lymphoma receptor tyrosine kinase (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgEGFR(A)epidermal growth factor receptor (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgEGFR(B)epidermal growth factor receptor (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgKRAS(A)KRAS proto-oncogene, GTPase (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgKRAS(B)KRAS proto-oncogene, GTPase (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgEML4echinoderm microtubule associated protein like 4 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgALK(Chr. Inv.)anaplastic lymphoma receptor tyrosine kinase (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgAAVS1(A)adeno-associated virus integration site 1 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
sgAAVS1(B)adeno-associated virus integration site 1 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21.
pPEPX-P3-sgRNAlucsgRNA targeting firefly luciferase encoding gene (Synthetic)Bacterial Expression, CRISPR Veening High-throughput CRISPRi phenotyping identifies new essential genes in Streptococcus pneumoniae. Mol Syst Biol. 2017 May 10;13(5):931. doi: 10.15252/msb.20167449.
pAW014-2ugtP-gRNA.P395TBacterial Expression Chou Development of a CRISPR-Cas9 toolkit for comprehensive engineering of Bacillus subtilis. Appl Environ Microbiol. 2016 Jun 3. pii: AEM.01159-16.
pEJS468-pLK.O1-NmeSgRNA/DTS13-Telomeretelomere sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sontheimer Naturally Occurring Off-Switches for CRISPR-Cas9. Cell. 2016 Dec 15;167(7):1829-1838.e9. doi: 10.1016/j.cell.2016.11.017. Epub 2016 Dec 8.
pEJS469-pLK.O1-SpySgRNA/DTS13-Telomeretelomere sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sontheimer Naturally Occurring Off-Switches for CRISPR-Cas9. Cell. 2016 Dec 15;167(7):1829-1838.e9. doi: 10.1016/j.cell.2016.11.017. Epub 2016 Dec 8.
pEJS476-pHAGE-TO-Nme dCas9 3XGFP-SgRNA/Telomere-All-in-oneNme dCas9 (Synthetic), telomere sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sontheimer Naturally Occurring Off-Switches for CRISPR-Cas9. Cell. 2016 Dec 15;167(7):1829-1838.e9. doi: 10.1016/j.cell.2016.11.017. Epub 2016 Dec 8.
pEJS477-pHAGE-TO-Spy dCas9 3XmCherry-SgRNA/Telomere-All-in-oneSp dCas9 (Synthetic), telomere sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sontheimer Naturally Occurring Off-Switches for CRISPR-Cas9. Cell. 2016 Dec 15;167(7):1829-1838.e9. doi: 10.1016/j.cell.2016.11.017. Epub 2016 Dec 8.
pX330-H11r1-2-DD-Cas9DD-SpCas9 (Other)Mammalian Expression, CRISPR Calos In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining. Nucleic Acids Res. 2016 Jan 13. pii: gkv1542.
pAGM4723:TpCC_UreaseCas9 (Other), Urease-targeting gRNA 1 (Other), Urease-targeting gRNA 2 (Other)CRISPR ; Diatom (T. pseudonana) Mock Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana Plant Methods 2016, 12:49
AAT_g1 gRNApU6-AAT_g1 sgRNA (Other)Mammalian Expression, CRISPR Cantz Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198.
AAT_g2 gRNApU6-AAT_g2 sgRNA (Other)Mammalian Expression, CRISPR Cantz Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198.
Lenti CGIP + Z-AAT targetCAG promoter (Other), Z-AAT target (Homo sapiens)Lentiviral Cantz Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198.
Lenti CGIP + M-AAT targetCAG promoter (Other), M-AAT target (Homo sapiens)Lentiviral Cantz Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198.
Lenti CGIP + TTR targetCAG promoter (Other), TTR target (Homo sapiens)Lentiviral Cantz Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198.
LentiCRISPR-sgPREX1gRNA targeting PREX1Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.
LentiCRISPR-sgSHOC2-1sgRNA 1 targeting SHOC2Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.
LentiCRISPR-sgSHOC2-2sgRNA 2 targeting SHOC2Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.
LentiCRISPR-sgC1orf27-1sgRNA 1 targeting C1orf27 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.
LentiCRISPR-sgC1orf27-2sgRNA 2 targeting C1orf27Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.
LentiCRISPR-sgUBA5sgRNA targeting UBA5Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.
LentiCRISPR-sgUFM1sgRNA targeting UFM1Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.
LentiCRISPR-sgUFSP2sgRNA targeting UFSP2Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.
LentiCRISPR-sgC17orf89-2sgRNA targeting C17orf89Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.
LentiCRISPR-sgC17orf89-3sgRNA 3 targeting C17orf89Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.
LentiCRISPR-sgC17orf89-1sgRNA 1 targeting C17orf89Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013.
pX335-EN475spCas9-nickase and sgRNA against mouse CTCF STOP Codon (Mus musculus)Mammalian Expression, Mouse Targeting Bruneau Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization. Cell. 2017 May 18;169(5):930-944.e22. doi: 10.1016/j.cell.2017.05.004.
pX335-EN477spCas9-nickase and sgRNA against mouse CTCF STOP Codon (Mus musculus)Mammalian Expression, Mouse Targeting Bruneau Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization. Cell. 2017 May 18;169(5):930-944.e22. doi: 10.1016/j.cell.2017.05.004.
pX330-EN479spCas9-nickase and sgRNA against mouse rosa26 locus (Mus musculus)Mammalian Expression, Mouse Targeting Bruneau Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization. Cell. 2017 May 18;169(5):930-944.e22. doi: 10.1016/j.cell.2017.05.004.
PX458_KDM1A_1gRNA against KDM1A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KDM1A_2gRNA against KDM1A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_FOXP1_1gRNA against FOXP1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_FOXP1_2gRNA against FOXP1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_HLF_1gRNA against HLF (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_HLF_2gRNA against HLF (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_MBD1_iso1_1gRNA against MBD1_iso1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_MBD1_iso1_2gRNA against MBD1_iso1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZNF644_1gRNA against ZNF644 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZNF644_2gRNA against ZNF644 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KDM6A_1gRNA against KDM6A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KDM6A_2gRNA against KDM6A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KAT7_1gRNA against KAT7 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_SAP130_1gRNA against SAP130 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_SAP130_2gRNA against SAP130 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZSCAN9_1gRNA against ZSCAN9 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZSCAN9_2gRNA against ZSCAN9 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KLF11_1gRNA against KLF11 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KLF11_2gRNA against KLF11 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZNF652_1gRNA against ZNF652 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZNF652_2gRNA against ZNF652 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_HMG20A_1gRNA against HMG20A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_HMG20A_2gRNA against HMG20A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_HBP1_1gRNA against HBP1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KDM3A_1gRNA against KDM3A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KDM3A_2gRNA against KDM3A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_MIER3_1gRNA against MIER3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_MIER3_2gRNA against MIER3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_TFE3_1gRNA against TFE3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_TFE3_2gRNA against TFE3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZGPAT_1gRNA against ZGPAT (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZGPAT_2gRNA against ZGPAT (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_MLX_1gRNA against MLX (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_MLX_2gRNA against MLX (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZNF580_1gRNA against ZNF580 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZNF580_2gRNA against ZNF580 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_GATAD2A_1gRNA against GATAD2A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_GATAD2A_2gRNA against GATAD2A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_MIXL1_1gRNA against MIXL1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_MIXL1_2gRNA against MIXL1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_TEAD3_1gRNA against TEAD3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_TEAD3_2gRNA against TEAD3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZNF792_1gRNA against ZNF792 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZNF792_2gRNA against ZNF792 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_NCoA2_1gRNA against NCoA2 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_NR2F6_1gRNA against NR2F6 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_NR2F6_2gRNA against NR2F6 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_CEBPG_1gRNA against CEBPG (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_CEBPG_2gRNA against CEBPG (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KLF9_1gRNA against KLF9 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KLF9_2gRNA against KLF9 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_NFIL3_1gRNA against NFIL3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_NFIL3_2gRNA against NFIL3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ARID5B_1gRNA against ARID5B (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ARID5B_2gRNA against ARID5B (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_HOMEZ_1gRNA against HOMEZ (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_HOMEZ_2gRNA against HOMEZ (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_DMAP1_1gRNA against DMAP1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_DMAP1_2gRNA against DMAP1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_TEAD1_1gRNA against TEAD1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_SOX5_1gRNA against SOX5 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_CEBPA_1gRNA against CEBPA (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_CEBPA_2gRNA against CEBPA (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZFP1_iso1_1gRNA against ZFP1_iso1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ZFP1_iso1_2gRNA against ZFP1_iso1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_SP5_1gRNA against SP5 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_SP5_2gRNA against SP5 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_RFXANK_1gRNA against RFXANK (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_RFXANK_2gRNA against RFXANK (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
eSpCas9(1.1)_No_FLAG_ATP1A1_G2ATP1A1 G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1) (Other)Mammalian Expression, CRISPR ; Co-selection via NHEJ using ouabain Doyon Marker-free coselection for CRISPR-driven genome editing in human cells. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265.
eSpCas9(1.1)_No_FLAG_ATP1A1_G3ATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1) (Other)Mammalian Expression, CRISPR ; Co-selection via HDR using ouabain Doyon Marker-free coselection for CRISPR-driven genome editing in human cells. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265.
pY036_ATP1A1_G3ATP1A1 G3 crRNA + AsCpf1-3xHA (Other)Mammalian Expression, CRISPR ; Co-selection via NHEJ using ouabain Doyon Marker-free coselection for CRISPR-driven genome editing in human cells. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265.
pY036_ATP1A1_G5ATP1A1 G5 crRNA + AsCpf1-3xHA (Other)Mammalian Expression, CRISPR ; Co-selection via HDR using ouabain Doyon Marker-free coselection for CRISPR-driven genome editing in human cells. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265.
pU6-gRNA-TAZU6-gRNA-TAZ (Homo sapiens)CRISPR Pu Efficient, footprint-free human iPSC genome editing by consolidation of Cas9/CRISPR and piggyBac technologies. Nat Protoc. 2017 Jan;12(1):88-103. doi: 10.1038/nprot.2016.152. Epub 2016 Dec 8.
[email protected]sgRNA against GLABROUS1 (Synthetic)Plant Expression, Synthetic Biology Weber An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana. Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017.
HUWE1-sgRNA-1HUWE1 sgRNA1 (Homo sapiens)Mammalian Expression Ye The HECT domain ubiquitin ligase HUWE1 targets unassembled soluble proteins for degradation. Cell Discov. 2016 Nov 8;2:16040. eCollection 2016.
HUWE1-sgRNA-2HUWE1 sgRNA2 (Homo sapiens)Mammalian Expression Ye The HECT domain ubiquitin ligase HUWE1 targets unassembled soluble proteins for degradation. Cell Discov. 2016 Nov 8;2:16040. eCollection 2016.
pJB172gRNA targeting pil1 (Schizosaccharomyces pombe)Yeast Expression Berro Use of a fluoride channel as a new selection marker for fission yeast plasmids and application to fast genome editing with CRISPR/Cas9. Yeast. 2016 Oct;33(10):549-557. doi: 10.1002/yea.3178. Epub 2016 Sep 7.
Tubb3gRNA-mCherryMouse Tubb3 gRNA (Synthetic)CRISPR Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16.
pAAV-mTubb3U6-mTubb3sgRNA-GFP-EF1a-mCherryKASH-hGHpA (Synthetic)AAV, CRISPR Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16.
pAAV-Ai14-HITIU6-Ai14sgRNA-GFPNLS-EF1a-mCherryKASH-pA (Synthetic)AAV, CRISPR Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16.
pAAV-Ai14-lucU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA (Synthetic)AAV, CRISPR, Luciferase Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16.
pAAV-rMERTK-HITIU6-rMertksgRNA-Mertk(intron1-2)-nEF-GFPKASH-pA (Synthetic)AAV, CRISPR Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16.
lenti-Cas9-VQR-GFP_activity_reporterGFP and sgRNA targeting GFP (NGA restricted)Lentiviral Bauer Variant-aware saturating mutagenesis using multiple Cas9 nucleases identifies regulatory elements at trait-associated loci. Nat Genet. 2017 Feb 20. doi: 10.1038/ng.3793.
pCDNA-H1-sgRNA-hTZAPTZAP (Homo sapiens)Mammalian Expression, CRISPR Lazzerini Denchi TZAP: A telomere-associated protein involved in telomere length control. Science. 2017 Jan 12. pii: aah6752. doi: 10.1126/science.aah6752.
pCDNA-H1-sgRNA-mTZAPTZAP (Mus musculus)Mammalian Expression, CRISPR Lazzerini Denchi TZAP: A telomere-associated protein involved in telomere length control. Science. 2017 Jan 12. pii: aah6752. doi: 10.1126/science.aah6752.
pX335 HTT sgRNA-bHTT (Homo sapiens)Mammalian Expression, CRISPR Pouladi Reversal of Phenotypic Abnormalities by CRISPR/Cas9-Mediated Gene Correction in Huntington Disease Patient-Derived Induced Pluripotent Stem Cells. Stem Cell Reports. 2017 Feb 21. pii: S2213-6711(17)30038-3. doi: 10.1016/j.stemcr.2017.01.022.
pX335 HTT sgRNA-aHTT (Homo sapiens)Mammalian Expression, CRISPR Pouladi Reversal of Phenotypic Abnormalities by CRISPR/Cas9-Mediated Gene Correction in Huntington Disease Patient-Derived Induced Pluripotent Stem Cells. Stem Cell Reports. 2017 Feb 21. pii: S2213-6711(17)30038-3. doi: 10.1016/j.stemcr.2017.01.022.
p426_Cas9_gRNA-ARS106aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS208aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS308aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-RDS1aHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS416dHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS511bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS607c Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-SAP155bHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-SAP155c Human Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-CAN1yHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS720aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS805aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS911bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS1021bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS1014aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS1114aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS1206aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS1309aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS1414aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-YOLCd1bHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-HIS3bHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-ARS1622bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-YPRCd15cHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-R-RDS1aHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p425_Cas9_gRNA_LEU_1014aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-R-ARS805aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
p426_Cas9_gRNA-R-ARS607cHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28.
TLCV2-RB1sgRB1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR ; Doxycycline inducible; eGFP reporter Karpf Inducible LentiCRISPR v2 (unpublished)
Px461-Cas9n-Trp53-sgRNA-alphaTrp53 (Mus musculus)Mammalian Expression, CRISPR Massague The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell. 2017 Jan 5;20(1):70-86. doi: 10.1016/j.stem.2016.10.002. Epub 2016 Nov 23.
Px461-Cas9n-Trp53-sgRNA-betaTrp53 (Mus musculus)Mammalian Expression, CRISPR Massague The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell. 2017 Jan 5;20(1):70-86. doi: 10.1016/j.stem.2016.10.002. Epub 2016 Nov 23.
Px458-Cas9n-Trp63-Exon4-1sgRNATrp63 (Mus musculus)Mammalian Expression, CRISPR Massague The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell. 2017 Jan 5;20(1):70-86. doi: 10.1016/j.stem.2016.10.002. Epub 2016 Nov 23.
Px458-Cas9n-Trp63-Exon4-2sgRNATrp63 (Mus musculus)Mammalian Expression, CRISPR Massague The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell. 2017 Jan 5;20(1):70-86. doi: 10.1016/j.stem.2016.10.002. Epub 2016 Nov 23.
Px458-Cas9n-Trp73-Exon4-3sgRNATrp73 (Mus musculus)Mammalian Expression, CRISPR Massague The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell. 2017 Jan 5;20(1):70-86. doi: 10.1016/j.stem.2016.10.002. Epub 2016 Nov 23.
Px458-Cas9n-Trp73-Exon4-4sgRNATrp73 (Mus musculus)Mammalian Expression, CRISPR Massague The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell. 2017 Jan 5;20(1):70-86. doi: 10.1016/j.stem.2016.10.002. Epub 2016 Nov 23.
LentiGuidPuro-hTP53_sgRNA-1Trp53 (Homo sapiens)Mammalian Expression, CRISPR Massague The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell. 2017 Jan 5;20(1):70-86. doi: 10.1016/j.stem.2016.10.002. Epub 2016 Nov 23.
LentiGuidPuro-hTP63_sgRNA-1Trp63 (Homo sapiens)Mammalian Expression, CRISPR Massague The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell. 2017 Jan 5;20(1):70-86. doi: 10.1016/j.stem.2016.10.002. Epub 2016 Nov 23.
LentiGuidPuro-hTP73_sgRNA-1Trp73 (Homo sapiens)Mammalian Expression, CRISPR Massague The p53 Family Coordinates Wnt and Nodal Inputs in Mesendodermal Differentiation of Embryonic Stem Cells. Cell Stem Cell. 2017 Jan 5;20(1):70-86. doi: 10.1016/j.stem.2016.10.002. Epub 2016 Nov 23.
1183_pAAV-U6-Ex14-gRNAd-CB-EmGFPEmGFP (Other)Mammalian Expression, AAV, CRISPR Lagor Somatic genome editing with CRISPR/Cas9 generates and corrects a metabolic disease. Sci Rep. 2017 Mar 16;7:44624. doi: 10.1038/srep44624.
1184_pAAV-U6-ApoB-gRNA2-CB-EmGFPEmGFP (Other)Mammalian Expression, AAV, CRISPR Lagor Somatic genome editing with CRISPR/Cas9 generates and corrects a metabolic disease. Sci Rep. 2017 Mar 16;7:44624. doi: 10.1038/srep44624.
pTX198OsPDS-gRNA01 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.
pTX199OsPDS-gRNA02 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.
pTX200OsYSA-gRNA01 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.
pTX201OsYSA-gRNA02 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.
pTX202OsDEP1-gRNA01 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.
pTX203OsDEP1-gRNA02 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.
pTX208OsYSA-gRNA01 and OsYSA-gRNA02 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.
pTX209OsPDS-gRNA01 and OsPDS-gRNA02 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19.
Lenti-sgApc/CregRNA targeting Apc (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgArid1a/CregRNA targeting Arid1a (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgAtm/CregRNA targeting Atm (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgCdkn2a/CregRNA targeting Cdkn2a (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgKeap1/CregRNA targeting Keap1 (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgp53/CregRNA targeting p53 (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgRb1/CregRNA targeting Rb1 (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgRbm10/CregRNA targeting Rbm10 (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgSetd2#1/CregRNA targeting Setd2 (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgSetd2#2/CregRNA targeting Setd2 (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgSmad4/CregRNA targeting Smad4 (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgNeo2/CregRNA targeting Neomycin (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgNeo3/CregRNA targeting Neomycin (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
Lenti-sgNT3/Crenon-targeting gRNA (Mus musculus)Mammalian Expression, Lentiviral, Cre/Lox Winslow A quantitative and multiplexed approach to uncover the fitness landscape of tumor suppression in vivo. Nat Methods. 2017 May 22. doi: 10.1038/nmeth.4297.
p426-SNR52p-gRNA.clr-2.Y-SUP4tgRNA for clr-2 locus (Other)CRISPR ; gRNA Hong Efficient gene editing in Neurospora crassa with CRISPR technology Fungal Biology and Biotechnology 2015, 2:4
pX335A_hCas9(D10A)_IRF8gRNA1IRF8 gRNA1 (Homo sapiens)Mammalian Expression, CRISPR Zenke Modelling IRF8 Deficient Human Hematopoiesis and Dendritic Cell Development with Engineered iPS Cells. Stem Cells. 2017 Jan 16. doi: 10.1002/stem.2565.
pX335A_hCas9(D10A)_IRF8gRNA2IRF8 gRNA2 (Homo sapiens)Mammalian Expression, CRISPR Zenke Modelling IRF8 Deficient Human Hematopoiesis and Dendritic Cell Development with Engineered iPS Cells. Stem Cells. 2017 Jan 16. doi: 10.1002/stem.2565.
pX335A_hCas9(D10A)_IRF8gRNA3IRF8 gRNA3 (Homo sapiens)Mammalian Expression, CRISPR Zenke Modelling IRF8 Deficient Human Hematopoiesis and Dendritic Cell Development with Engineered iPS Cells. Stem Cells. 2017 Jan 16. doi: 10.1002/stem.2565.
pX335A_hCas9(D10A)_IRF8gRNA4IRF8 gRNA4 (Homo sapiens)Mammalian Expression, CRISPR Zenke Modelling IRF8 Deficient Human Hematopoiesis and Dendritic Cell Development with Engineered iPS Cells. Stem Cells. 2017 Jan 16. doi: 10.1002/stem.2565.
pKDsgRNA-malGmalG gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-arsBarsB gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-rpsLrpsL gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-hisGhisG gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-trmItrmI gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-torZtorZ gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-rssArssA gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-yhhTyhhT gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-lpoBlpoB gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-NTempty gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-rbsKrbsK gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-xylAxylA gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-srlAsrlA gRNABacterial Expression Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pCAS_gpyrG1gRNA (pyrg1) (Other)Bacterial Expression ; A. niger Sauer An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30643-0. doi: 10.1016/j.biortech.2017.05.004.
pCAS_gpyrG2gRNA (pyrg2) (Other)Bacterial Expression ; A. niger Sauer An efficient tool for metabolic pathway construction and gene integration for Aspergillus niger. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30643-0. doi: 10.1016/j.biortech.2017.05.004.
ACTL6A C7.3 gRNAACTL6A (Guide Designation C7.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ACTL6A C8.3 gRNAACTL6A (Guide Designation C8.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ACTR1A C9.5 gRNAACTR1A (Guide Designation C9.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ACTR1A C10.5 gRNAACTR1A (Guide Designation C10.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ACTR1B C11.5 gRNAACTR1B (Guide Designation C11.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ACTR1B C12.5 gRNAACTR1B (Guide Designation C12.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
AHCTF1 A7.2 gRNAAHCTF1 (Guide Designation A7.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
AHCTF1 A8.2 gRNAAHCTF1 (Guide Designation A8.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ANAPC1 A1.3 gRNAANAPC1 (Guide Designation A1.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ANAPC1 A2.3 gRNAANAPC1 (Guide Designation A2.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ANLN A1.2 gRNAANLN (Guide Designation A1.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ANLN A2.2 gRNAANLN (Guide Designation A2.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ARPC4 C7.4 gRNAARPC4 (Guide Designation C7.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ARPC4 C8.4 gRNAARPC4 (Guide Designation C8.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ASF1B A3.2 gRNAASF1B (Guide Designation A3.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ASF1B A4.2 gRNAASF1B (Guide Designation A4.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ASPM A5.2 gRNAASPM (Guide Designation A5.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ATAD2 D7.3 gRNAATAD2 (Guide Designation D7.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ATAD2 D8.3 gRNAATAD2 (Guide Designation D8.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
AURKA A1.1 gRNAAURKA (Guide Designation A1.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
AURKA A2.1 gRNAAURKA (Guide Designation A2.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
AURKA A1.4 gRNAAURKA (Guide Designation A1.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
AURKA A2.4 gRNAAURKA (Guide Designation A2.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
AURKB A3.1 gRNAAURKB (Guide Designation A3.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
AURKB A4.1 gRNAAURKB (Guide Designation A4.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
AURKB A3.4 gRNAAURKB (Guide Designation A3.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
AURKB A4.4 gRNAAURKB (Guide Designation A4.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
BRCA1 A9.2 gRNABRCA1 (Guide Designation A9.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
BRCA1 A10.2 gRNABRCA1 (Guide Designation A10.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
BRCA2 A11.2 gRNABRCA2 (Guide Designation A11.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
BRCA2 A12.2 gRNABRCA2 (Guide Designation A12.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
BUB1 A5.1 gRNABUB1 (Guide Designation A5.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
BUB1 A6.1 gRNABUB1 (Guide Designation A6.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
BUB1B A7.1 gRNABUB1B (Guide Designation A7.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
BUB1B A8.1 gRNABUB1B (Guide Designation A8.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
BUB3 A9.1 gRNABUB3 (Guide Designation A9.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
BUB3 A10.1 gRNABUB3 (Guide Designation A10.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CAMSAP1 E4.5 gRNACAMSAP1 (Guide Designation E4.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CAMSAP1 E5.5 gRNACAMSAP1 (Guide Designation E5.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CAMSAP2 E6.5 gRNACAMSAP2 (Guide Designation E6.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CAMSAP2 E7.5 gRNACAMSAP2 (Guide Designation E7.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CAMSAP3 E8.5 gRNACAMSAP3 (Guide Designation E8.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CAMSAP3 E9.5 gRNACAMSAP3 (Guide Designation E9.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CASC5 A11.1 gRNACASC5 (Guide Designation A11.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CASC5 A12.1 gRNACASC5 (Guide Designation A12.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CBX1 A3.5 gRNACBX1 (Guide Designation A3.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CBX1 A4.5 gRNACBX1 (Guide Designation A4.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CBX3 A5.5 gRNACBX3 (Guide Designation A5.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CBX3 A6.5 gRNACBX3 (Guide Designation A6.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CBX5 A1.5 gRNACBX5 (Guide Designation A1.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CBX5 A2.5 gRNACBX5 (Guide Designation A2.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCNA1 C7.5 gRNACCNA1 (Guide Designation C7.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCNA1 C8.5 gRNACCNA1 (Guide Designation C8.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCNA2 B1.1 gRNACCNA2 (Guide Designation B1.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCNA2 B2.1 gRNACCNA2 (Guide Designation B2.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCNB1 B3.1 gRNACCNB1 (Guide Designation B3.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCNB1 B4.1 gRNACCNB1 (Guide Designation B4.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCNB2 C5.5 gRNACCNB2 (Guide Designation C5.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCNB2 C6.5 gRNACCNB2 (Guide Designation C6.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCT5 C11.3 gRNACCT5 (Guide Designation C11.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCT5 C12.3 gRNACCT5 (Guide Designation C12.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCT5 B7.4 gRNACCT5 (Guide Designation B7.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CCT5 B8.4 gRNACCT5 (Guide Designation B8.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC20 D3.1 gRNACDC20 (Guide Designation D3.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC20 D4.1 gRNACDC20 (Guide Designation D4.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC25A B1.2 gRNACDC25A (Guide Designation B1.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC25A B2.2 gRNACDC25A (Guide Designation B2.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC25B B3.2 gRNACDC25B (Guide Designation B3.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC25B B4.2 gRNACDC25B (Guide Designation B4.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC25C B5.2 gRNACDC25C (Guide Designation B5.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC25C B6.2 gRNACDC25C (Guide Designation B6.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC34 B7.2 gRNACDC34 (Guide Designation B7.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC34 B8.2 gRNACDC34 (Guide Designation B8.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC45 B9.2 gRNACDC45 (Guide Designation B9.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC45 B10.2 gRNACDC45 (Guide Designation B10.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC6 B5.1 gRNACDC6 (Guide Designation B5.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDC6 B6.1 gRNACDC6 (Guide Designation B6.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDCA3 B11.6 gRNACDCA3 (Guide Designation B11.6) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDCA3 B12.6 gRNACDCA3 (Guide Designation B12.6) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDCA5 C9.4 gRNACDCA5 (Guide Designation C9.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDCA5 C10.4 gRNACDCA5 (Guide Designation C10.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDCA8 B5.6 gRNACDCA8 (Guide Designation B5.6) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDCA8 B6.6 gRNACDCA8 (Guide Designation B6.6) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDK1 B7.1 gRNACDK1 (Guide Designation B7.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDK1 B8.1 gRNACDK1 (Guide Designation B8.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDK5RAP2 F11.3 gRNACDK5RAP2 (Guide Designation F11.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDK5RAP2 F12.3 gRNACDK5RAP2 (Guide Designation F12.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDT1 B9.1 gRNACDT1 (Guide Designation B9.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CDT1 B10.1 gRNACDT1 (Guide Designation B10.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPA B11.1 gRNACENPA (Guide Designation B11.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPA B12.1 gRNACENPA (Guide Designation B12.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPB C1.1 gRNACENPB (Guide Designation C1.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPB C2.1 gRNACENPB (Guide Designation C2.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPE C3.1 gRNACENPE (Guide Designation C3.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPE C4.1 gRNACENPE (Guide Designation C4.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPF C5.1 gRNACENPF (Guide Designation C5.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPF C6.1 gRNACENPF (Guide Designation C6.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPJ C7.1 gRNACENPJ (Guide Designation C7.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPJ C8.1 gRNACENPJ (Guide Designation C8.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPW H3.3 gRNACENPW (Guide Designation H3.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CENPW H4.3 gRNACENPW (Guide Designation H4.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CEP55 B11.2 gRNACEP55 (Guide Designation B11.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CEP55 B12.2 gRNACEP55 (Guide Designation B12.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CFDP1 C11.4 gRNACFDP1 (Guide Designation C11.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CFDP1 C12.4 gRNACFDP1 (Guide Designation C12.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CHEK1 C1.2 gRNACHEK1 (Guide Designation C1.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CHEK1 C2.2 gRNACHEK1 (Guide Designation C2.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CHEK2 C3.2 gRNACHEK2 (Guide Designation C3.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CKAP5 C5.2 gRNACKAP5 (Guide Designation C5.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CKAP5 C6.2 gRNACKAP5 (Guide Designation C6.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CKS2 C7.2 gRNACKS2 (Guide Designation C7.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CKS2 C8.2 gRNACKS2 (Guide Designation C8.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CLTC G9.4 gRNACLTC (Guide Designation G9.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CLTC G10.4 gRNACLTC (Guide Designation G10.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CMAS C1.3 gRNACMAS (Guide Designation C1.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CMAS C2.3 gRNACMAS (Guide Designation C2.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
COPS3 G11.4 gRNACOPS3 (Guide Designation G11.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
COPS3 G12.4 gRNACOPS3 (Guide Designation G12.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CSNK1A1 H1.4 gRNACSNK1A1 (Guide Designation H1.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CSNK1A1 H2.4 gRNACSNK1A1 (Guide Designation H2.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CSNK2B H3.4 gRNACSNK2B (Guide Designation H3.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CSNK2B H4.4 gRNACSNK2B (Guide Designation H4.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CTPS1 E11.3 gRNACTPS1 (Guide Designation E11.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
CTPS1 E12.3 gRNACTPS1 (Guide Designation E12.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DBF4 C9.1 gRNADBF4 (Guide Designation C9.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DCTN5 C1.4 gRNADCTN5 (Guide Designation C1.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DCTN5 C2.4 gRNADCTN5 (Guide Designation C2.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DHCR7 B5.3 gRNADHCR7 (Guide Designation B5.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DHCR7 B6.3 gRNADHCR7 (Guide Designation B6.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DKC1 F1.3 gRNADKC1 (Guide Designation F1.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DLGAP5 D1.4 gRNADLGAP5 (Guide Designation D1.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DLGAP5 D2.4 gRNADLGAP5 (Guide Designation D2.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DSN1 C11.1 gRNADSN1 (Guide Designation C11.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DSN1 C12.1 gRNADSN1 (Guide Designation C12.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNC1H1 D1.1 gRNADYNC1H1 (Guide Designation D1.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNC1H1 D2.1 gRNADYNC1H1 (Guide Designation D2.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNLL1 A7.5 gRNADYNLL1 (Guide Designation A7.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNLL1 A8.5 gRNADYNLL1 (Guide Designation A8.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNLL2 A9.5 gRNADYNLL2 (Guide Designation A9.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNLL2 A10.5 gRNADYNLL2 (Guide Designation A10.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNLRB1 H12.3 gRNADYNLRB1 (Guide Designation H12.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNLRB2 A11.5 gRNADYNLRB2 (Guide Designation A11.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNLRB2 A12.5 gRNADYNLRB2 (Guide Designation A12.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNLT1 B1.5 gRNADYNLT1 (Guide Designation B1.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNLT1 B2.5 gRNADYNLT1 (Guide Designation B2.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
DYNLT3 B4.5 gRNADYNLT3 (Guide Designation B4.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ECT2 D5.1 gRNAECT2 (Guide Designation D5.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ECT2 D6.1 gRNAECT2 (Guide Designation D6.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ECT2 B1.4 gRNAECT2 (Guide Designation B1.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ECT2 B2.4 gRNAECT2 (Guide Designation B2.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ELAVL1 B11.4 gRNAELAVL1 (Guide Designation B11.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ELAVL1 B12.4 gRNAELAVL1 (Guide Designation B12.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ELAVL1 E5.3 gRNAELAVL1 (Guide Designation E5.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ELAVL1 E6.3 gRNAELAVL1 (Guide Designation E6.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ESCO2 C9.2 gRNAESCO2 (Guide Designation C9.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ESCO2 C10.2 gRNAESCO2 (Guide Designation C10.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ESPL1 D7.1 gRNAESPL1 (Guide Designation D7.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
EZH2 E9.3 gRNAEZH2 (Guide Designation E9.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
EZH2 E10.3 gRNAEZH2 (Guide Designation E10.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
FBXO5 D3.4 gRNAFBXO5 (Guide Designation D3.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
FBXO5 D4.4 gRNAFBXO5 (Guide Designation D4.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
FEN1 C9.3 gRNAFEN1 (Guide Designation C9.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
FEN1 C10.3 gRNAFEN1 (Guide Designation C10.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
FOXM1 C11.2 gRNAFOXM1 (Guide Designation C11.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
FOXM1 C12.2 gRNAFOXM1 (Guide Designation C12.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
FZR1 D9.1 gRNAFZR1 (Guide Designation D9.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
FZR1 D10.1 gRNAFZR1 (Guide Designation D10.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
GINS1 D11.1 gRNAGINS1 (Guide Designation D11.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
GINS1 D12.1 gRNAGINS1 (Guide Designation D12.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
GMNN D1.2 gRNAGMNN (Guide Designation D1.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
GMNN D2.2 gRNAGMNN (Guide Designation D2.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
GPSM2 F3.3 gRNAGPSM2 (Guide Designation F3.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
GPSM2 F4.3 gRNAGPSM2 (Guide Designation F4.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
GSG2 E2.1 gRNAGSG2 (Guide Designation E2.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
H2AFX B3.3 gRNAH2AFX (Guide Designation B3.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
H2AFX B4.3 gRNAH2AFX (Guide Designation B4.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
H2AFZ B1.3 gRNAH2AFZ (Guide Designation B1.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
H2AFZ B2.3 gRNAH2AFZ (Guide Designation B2.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
HAUS8 D3.2 gRNAHAUS8 (Guide Designation D3.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
HAUS8 D4.2 gRNAHAUS8 (Guide Designation D4.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
HDGF A7.3 gRNAHDGF (Guide Designation A7.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
HDGF A8.3 gRNAHDGF (Guide Designation A8.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
HJURP E3.1 gRNAHJURP (Guide Designation E3.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
HJURP E4.1 gRNAHJURP (Guide Designation E4.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
INCENP G3.3 gRNAINCENP (Guide Designation G3.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
INCENP G4.3 gRNAINCENP (Guide Designation G4.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ITGB3BP E5.1 gRNAITGB3BP (Guide Designation E5.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ITGB3BP E6.1 gRNAITGB3BP (Guide Designation E6.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KIF11 F5.3 gRNAKIF11 (Guide Designation F5.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KIF11 F6.3 gRNAKIF11 (Guide Designation F6.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KIF20A D5.2 gRNAKIF20A (Guide Designation D5.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KIF20A D6.2 gRNAKIF20A (Guide Designation D6.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KIF2A D7.2 gRNAKIF2A (Guide Designation D7.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KIF2A D8.2 gRNAKIF2A (Guide Designation D8.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KIF2C E7.1 gRNAKIF2C (Guide Designation E7.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KIF2C E8.1 gRNAKIF2C (Guide Designation E8.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KIF4A D9.2 gRNAKIF4A (Guide Designation D9.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KIF4A D10.2 gRNAKIF4A (Guide Designation D10.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KMT5A H1.3 gRNAKMT5A (Guide Designation H1.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KMT5A H2.3 gRNAKMT5A (Guide Designation H2.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KNSTRN D11.2 gRNAKNSTRN (Guide Designation D11.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KNSTRN D12.2 gRNAKNSTRN (Guide Designation D12.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KNTC1 A3.3 gRNAKNTC1 (Guide Designation A3.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KNTC1 A4.3 gRNAKNTC1 (Guide Designation A4.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KNTC1 A11.4 gRNAKNTC1 (Guide Designation A11.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
KNTC1 A12.4 gRNAKNTC1 (Guide Designation A12.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
LIN52 D5.4 gRNALIN52 (Guide Designation D5.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
LIN52 D6.4 gRNALIN52 (Guide Designation D6.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
LSM4 D9.3 gRNALSM4 (Guide Designation D9.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
LSM4 D10.3 gRNALSM4 (Guide Designation D10.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
LSM4 B5.4 gRNALSM4 (Guide Designation B5.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
LSM4 B6.4 gRNALSM4 (Guide Designation B6.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAD1L1 E9.1 gRNAMAD1L1 (Guide Designation E9.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAD1L1 E10.1 gRNAMAD1L1 (Guide Designation E10.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAD2L1 E11.1 gRNAMAD2L1 (Guide Designation E11.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAD2L1 E12.1 gRNAMAD2L1 (Guide Designation E12.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAD2L1BP F1.1 gRNAMAD2L1BP (Guide Designation F1.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAD2L1BP F2.1 gRNAMAD2L1BP (Guide Designation F2.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAPRE1 F9.3 gRNAMAPRE1 (Guide Designation F9.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAPRE1 F10.3 gRNAMAPRE1 (Guide Designation F10.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAPRE2 H5.3 gRNAMAPRE2 (Guide Designation H5.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAPRE2 H6.3 gRNAMAPRE2 (Guide Designation H6.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAPRE3 H7.3 gRNAMAPRE3 (Guide Designation H7.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MAPRE3 H8.3 gRNAMAPRE3 (Guide Designation H8.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MASTL F3.1 gRNAMASTL (Guide Designation F3.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MASTL B3.4 gRNAMASTL (Guide Designation B3.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MASTL B4.4 gRNAMASTL (Guide Designation B4.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MCM10 B9.6 gRNAMCM10 (Guide Designation B9.6) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MCM10 B10.6 gRNAMCM10 (Guide Designation B10.6) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MCM2 F5.1 gRNAMCM2 (Guide Designation F5.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MCM2 F6.1 gRNAMCM2 (Guide Designation F6.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MCM4 F7.1 gRNAMCM4 (Guide Designation F7.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MCM4 F8.1 gRNAMCM4 (Guide Designation F8.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MCM6 E2.2 gRNAMCM6 (Guide Designation E2.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MCM7 E3.2 gRNAMCM7 (Guide Designation E3.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MCM7 E4.2 gRNAMCM7 (Guide Designation E4.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MELK E5.2 gRNAMELK (Guide Designation E5.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MELK E6.2 gRNAMELK (Guide Designation E6.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MIS18BP1 F9.1 gRNAMIS18BP1 (Guide Designation F9.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MISP H9.2 gRNAMISP (Guide Designation H9.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MISP H10.2 gRNAMISP (Guide Designation H10.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MSH6 E7.3 gRNAMSH6 (Guide Designation E7.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MSH6 E8.3 gRNAMSH6 (Guide Designation E8.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MTCH2 D3.3 gRNAMTCH2 (Guide Designation D3.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
MTCH2 D4.3 gRNAMTCH2 (Guide Designation D4.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NAE1 G7.3 gRNANAE1 (Guide Designation G7.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NAE1 G8.3 gRNANAE1 (Guide Designation G8.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NCAPD2 E7.2 gRNANCAPD2 (Guide Designation E7.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NCAPD2 E8.2 gRNANCAPD2 (Guide Designation E8.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NCAPG E9.2 gRNANCAPG (Guide Designation E9.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NCAPG E10.2 gRNANCAPG (Guide Designation E10.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NCAPG2 E11.2 gRNANCAPG2 (Guide Designation E11.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NCAPG2 E12.2 gRNANCAPG2 (Guide Designation E12.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NCAPH B7.6 gRNANCAPH (Guide Designation B7.6) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NCAPH B8.6 gRNANCAPH (Guide Designation B8.6) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NDC80 F11.1 gRNANDC80 (Guide Designation F11.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NDC80 F12.1 gRNANDC80 (Guide Designation F12.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NDE1 F1.2 gRNANDE1 (Guide Designation F1.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NDE1 F2.2 gRNANDE1 (Guide Designation F2.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NDEL1 F3.2 gRNANDEL1 (Guide Designation F3.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NDUFAB1 C3.3 gRNANDUFAB1 (Guide Designation C3.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NDEL1 F4.2 gRNANDEL1 (Guide Designation F4.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NDUFAB1 C4.3 gRNANDUFAB1 (Guide Designation C4.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NEK2 F5.2 gRNANEK2 (Guide Designation F5.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NEK2 F6.2 gRNANEK2 (Guide Designation F6.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NEK2 A5.4 gRNANEK2 (Guide Designation A5.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NEK2 A6.4 gRNANEK2 (Guide Designation A6.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NEMP1 C5.3 gRNANEMP1 (Guide Designation C5.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NEMP1 C6.3 gRNANEMP1 (Guide Designation C6.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NIN G11.3 gRNANIN (Guide Designation G11.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NIN G12.3 gRNANIN (Guide Designation G12.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NIPBL D7.4 gRNANIPBL (Guide Designation D7.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NIPBL D8.4 gRNANIPBL (Guide Designation D8.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NSL1 C5.4 gRNANSL1 (Guide Designation C5.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NSL1 C6.4 gRNANSL1 (Guide Designation C6.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NUDC D9.4 gRNANUDC (Guide Designation D9.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NUDC D10.4 gRNANUDC (Guide Designation D10.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NUMA1 H11.2 gRNANUMA1 (Guide Designation H11.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NUMA1 H12.2 gRNANUMA1 (Guide Designation H12.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NUP107 F7.2 gRNANUP107 (Guide Designation F7.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NUP107 F8.2 gRNANUP107 (Guide Designation F8.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NUP205 F9.2 gRNANUP205 (Guide Designation F9.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NUP205 F10.2 gRNANUP205 (Guide Designation F10.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NXT1 A5.3 gRNANXT1 (Guide Designation A5.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
NXT1 A6.3 gRNANXT1 (Guide Designation A6.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ODF2 F7.3 gRNAODF2 (Guide Designation F7.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ODF2 F8.3 gRNAODF2 (Guide Designation F8.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
OIP5 B3.6 gRNAOIP5 (Guide Designation B3.6) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
OIP5 B4.6 gRNAOIP5 (Guide Designation B4.6) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ORC1 G1.1 gRNAORC1 (Guide Designation G1.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ORC1 G2.1 gRNAORC1 (Guide Designation G2.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PAFAH1B1 G9.3 gRNAPAFAH1B1 (Guide Designation G9.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PAFAH1B1 G10.3 gRNAPAFAH1B1 (Guide Designation G10.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PBK D1.3 gRNAPBK (Guide Designation D1.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PBK D2.3 gRNAPBK (Guide Designation D2.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PCM1 D11.4 gRNAPCM1 (Guide Designation D11.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PCM1 D12.4 gRNAPCM1 (Guide Designation D12.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PCNA G3.1 gRNAPCNA (Guide Designation G3.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PCNA G4.1 gRNAPCNA (Guide Designation G4.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PCNT E1.4 gRNAPCNT (Guide Designation E1.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PCNT E2.4 gRNAPCNT (Guide Designation E2.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PDCD2L B7.3 gRNAPDCD2L (Guide Designation B7.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PDCD2L B8.3 gRNAPDCD2L (Guide Designation B8.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PLK1 G5.1 gRNAPLK1 (Guide Designation G5.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PLK1 G6.1 gRNAPLK1 (Guide Designation G6.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
POC1A F11.2 gRNAPOC1A (Guide Designation F11.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
POC1A F12.2 gRNAPOC1A (Guide Designation F12.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
POC1B C3.4 gRNAPOC1B (Guide Designation C3.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
POC1B C4.4 gRNAPOC1B (Guide Designation C4.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
POT1 E3.4 gRNAPOT1 (Guide Designation E3.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
POT1 E4.4 gRNAPOT1 (Guide Designation E4.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PPP1CA C2.5 gRNAPPP1CA (Guide Designation C2.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PPP1CB C3.5 gRNAPPP1CB (Guide Designation C3.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PPP1CC C4.5 gRNAPPP1CC (Guide Designation C4.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PPP2R2A B5.5 gRNAPPP2R2A (Guide Designation B5.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PPP2R2B B6.5 gRNAPPP2R2B (Guide Designation B6.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PPP2R2C B7.5 gRNAPPP2R2C (Guide Designation B7.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PPP2R2D B8.5 gRNAPPP2R2D (Guide Designation B8.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PPP2R5B B10.5 gRNAPPP2R5B (Guide Designation B10.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PPP2R5C B11.5 gRNAPPP2R5C (Guide Designation B11.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PPP2R5D B12.5 gRNAPPP2R5D (Guide Designation B12.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PPP2R5E C1.5 gRNAPPP2R5E (Guide Designation C1.5) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PRC1 G1.2 gRNAPRC1 (Guide Designation G1.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PRC1 G2.2 gRNAPRC1 (Guide Designation G2.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PSMD14 E5.4 gRNAPSMD14 (Guide Designation E5.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PSMD14 E6.4 gRNAPSMD14 (Guide Designation E6.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PTTG1 G9.1 gRNAPTTG1 (Guide Designation G9.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PTTG1 G10.1 gRNAPTTG1 (Guide Designation G10.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PTTG1 A9.4 gRNAPTTG1 (Guide Designation A9.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
PTTG1 A10.4 gRNAPTTG1 (Guide Designation A10.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RACGAP1 E7.4 gRNARACGAP1 (Guide Designation E7.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RACGAP1 E8.4 gRNARACGAP1 (Guide Designation E8.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RAD21 G11.1 gRNARAD21 (Guide Designation G11.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RAD21 G12.1 gRNARAD21 (Guide Designation G12.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
Rad51AP1 B11.3 gRNARad51AP1 (Guide Designation B11.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
Rad51AP1 B12.3 gRNARad51AP1 (Guide Designation B12.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RAN G7.4 gRNARAN (Guide Designation G7.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RAN G8.4 gRNARAN (Guide Designation G8.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RANGAP1 G5.4 gRNARANGAP1 (Guide Designation G5.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RANGAP1 G6.4 gRNARANGAP1 (Guide Designation G6.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RCC1 G3.2 gRNARCC1 (Guide Designation G3.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RCC1 G4.2 gRNARCC1 (Guide Designation G4.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RFC4 D5.3 gRNARFC4 (Guide Designation D5.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RFC4 D6.3 gRNARFC4 (Guide Designation D6.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RNASEH2A B9.3 gRNARNASEH2A (Guide Designation B9.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RNASEH2A B10.3 gRNARNASEH2A (Guide Designation B10.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RRM1 E1.3 gRNARRM1 (Guide Designation E1.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RRM1 E2.3 gRNARRM1 (Guide Designation E2.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RRM2 E3.3 gRNARRM2 (Guide Designation E3.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
RRM2 E4.3 gRNARRM2 (Guide Designation E4.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SASS6 G1.3 gRNASASS6 (Guide Designation G1.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SASS6 G2.3 gRNASASS6 (Guide Designation G2.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SGO1 H1.1 gRNASGO1 (Guide Designation H1.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SGO1 H2.1 gRNASGO1 (Guide Designation H2.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SKA1 H3.1 gRNASKA1 (Guide Designation H3.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SKA1 H4.1 gRNASKA1 (Guide Designation H4.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SKA3 G5.2 gRNASKA3 (Guide Designation G5.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SKA3 G6.2 gRNASKA3 (Guide Designation G6.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SMC2 H5.1 gRNASMC2 (Guide Designation H5.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SMC2 H6.1 gRNASMC2 (Guide Designation H6.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SMC3 H7.1 gRNASMC3 (Guide Designation H7.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SMC3 H8.1 gRNASMC3 (Guide Designation H8.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SMC3 A7.4 gRNASMC3 (Guide Designation A7.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SMC3 A8.4 gRNASMC3 (Guide Designation A8.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SMC6 G3.4 gRNASMC6 (Guide Designation G3.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SMC6 G4.4 gRNASMC6 (Guide Designation G4.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SPAG5 G7.2 gRNASPAG5 (Guide Designation G7.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SPAG5 G8.2 gRNASPAG5 (Guide Designation G8.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SRSF2 A9.3 gRNASRSF2 (Guide Designation A9.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SRSF2 A10.3 gRNASRSF2 (Guide Designation A10.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SSRP1 G9.2 gRNASSRP1 (Guide Designation G9.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SSRP1 G10.2 gRNASSRP1 (Guide Designation G10.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SUGT1 E9.4 gRNASUGT1 (Guide Designation E9.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
SUGT1 E10.4 gRNASUGT1 (Guide Designation E10.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TBCB E11.4 gRNATBCB (Guide Designation E11.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TBCB E12.4 gRNATBCB (Guide Designation E12.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TGIF2 A11.3 gRNATGIF2 (Guide Designation A11.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TGIF2 A12.3 gRNATGIF2 (Guide Designation A12.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TGIF2 B9.4 gRNATGIF2 (Guide Designation B9.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TGIF2 B10.4 gRNATGIF2 (Guide Designation B10.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TOP2A G11.2 gRNATOP2A (Guide Designation G11.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TOP2A G12.2 gRNATOP2A (Guide Designation G12.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TOPBP1 G1.4 gRNATOPBP1 (Guide Designation G1.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TOPBP1 G2.4 gRNATOPBP1 (Guide Designation G2.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TPX2 H1.2 gRNATPX2 (Guide Designation H1.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TPX2 H2.2 gRNATPX2 (Guide Designation H2.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TRIP13 H3.2 gRNATRIP13 (Guide Designation H3.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TRIP13 H4.2 gRNATRIP13 (Guide Designation H4.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TTK H9.1 gRNATTK (Guide Designation H9.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TTK H10.1 gRNATTK (Guide Designation H10.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TUBB F1.4 gRNATUBB (Guide Designation F1.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TUBB F2.4 gRNATUBB (Guide Designation F2.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TUBD1 F3.4 gRNATUBD1 (Guide Designation F3.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TUBD1 F4.4 gRNATUBD1 (Guide Designation F4.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TUBE1 F5.4 gRNATUBE1 (Guide Designation F5.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TUBE1 F6.4 gRNATUBE1 (Guide Designation F6.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TUBG1 F7.4 gRNATUBG1 (Guide Designation F7.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
TUBG1 F8.4 gRNATUBG1 (Guide Designation F8.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
UBA1 G5.3 gRNAUBA1 (Guide Designation G5.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
UBA1 G6.3 gRNAUBA1 (Guide Designation G6.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
UBE2C H5.2 gRNAUBE2C (Guide Designation H5.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
UBE2C H6.2 gRNAUBE2C (Guide Designation H6.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
UNG D11.3 gRNAUNG (Guide Designation D11.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
UNG D12.3 gRNAUNG (Guide Designation D12.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
VCP F11.4 gRNAVCP (Guide Designation F11.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
VCP F12.4 gRNAVCP (Guide Designation F12.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
WEE1 F9.4 gRNAWEE1 (Guide Designation F9.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
WEE1 F10.4 gRNAWEE1 (Guide Designation F10.4) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ZW10 H9.3 gRNAZW10 (Guide Designation H9.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ZW10 H10.3 gRNAZW10 (Guide Designation H10.3) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ZWILCH H11.1 gRNAZWILCH (Guide Designation H11.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ZWILCH H12.1 gRNAZWILCH (Guide Designation H12.1) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ZWILCH B1.6 gRNAZWILCH (Guide Designation B1.6) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ZWINT H7.2 gRNAZWINT (Guide Designation H7.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
ZWINT H8.2 gRNAZWINT (Guide Designation H8.2) (Homo sapiens)Lentiviral, CRISPR Cheeseman Large-Scale Analysis of CRISPR/Cas9 Cell-Cycle Knockouts Reveals the Diversity of p53-Dependent Responses to Cell-Cycle Defects. Dev Cell. 2017 Feb 27;40(4):405-420.e2. doi: 10.1016/j.devcel.2017.01.012. Epub 2017 Feb 16.
pADH100-2NAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, FRT, DS_HIS1CRISPR Hernday An efficient, rapid, and recyclable system for CRISPR-mediated genome editing in Candida albicans mSphere Apr 2017, 2 (2) e00149-17
pADH118-2NAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. albicans LEU2 2 of 2CRISPR Hernday An efficient, rapid, and recyclable system for CRISPR-mediated genome editing in Candida albicans mSphere Apr 2017, 2 (2) e00149-17
pADH143-2NAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. maltosa LEU2 2 of 2CRISPR Hernday An efficient, rapid, and recyclable system for CRISPR-mediated genome editing in Candida albicans mSphere Apr 2017, 2 (2) e00149-17
pSC2 gRNAs targeting NCR genes (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pSC3 gRNAs targeting 58kb region in medicago truncatula (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pSC4 gRNAs targeting 58kb region in medicago truncatula (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC303 2 gRNAs targeting tomato ARF8A (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC3632 gRNAs targeting tomato ARF8A (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pAH750 2 gRNAs targeting tomato ARF8A (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC3642 gRNAs targeting tomato ARF8A (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC365 2 gRNAs targeting tomato ARF8A (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC3662 gRNAs targeting tomato ARF8A (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC362 gRNAs targeting 6 tomato genes (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC441gRNAs targeting MLO gene in barley (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC437gRNAs targeting MLO gene in barley (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC391gRNA targeting tomato ANT1 (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC393gRNA targeting tomato ANT1 (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC436gRNA targeting barley MLO (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC392gRNA targeting tomato ANT1 (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC394 gRNA targeting tomato ANT1 (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pTC440gRNA targeting barley MLO (Other)Plant Expression, CRISPR Voytas A multi-purpose toolkit to enable advanced genome engineering in plants. Plant Cell. 2017 May 18. pii: tpc.00922.2016. doi: 10.1105/tpc.16.00922.
pCRISPRi_Mxi1_yl_NHEJCodon optimized dCas9-Mxi1 (Synthetic), KU70 sgRNA expression cassette (Synthetic), KU80a sgRNA expression cassette (Synthetic), KU80b sgRNA expression cassette (Synthetic)Yeast Expression, CRISPR, Synthetic Biology Wheeldon CRISPRi repression of nonhomologous end-joining for enhanced genome engineering via homologous recombination in Yarrowia lipolytica. Biotechnol Bioeng. 2017 Aug 19. doi: 10.1002/bit.26404.
pPN186AKT3 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN187AKT3 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN007BCL11A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN008BCL11A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN190BRINP2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN191BRINP2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN160CACNB2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN161CACNB2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN260CLU (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN261CLU (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN254CNOT1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN255CNOT1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN166CNTN4 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN167CNTN4 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN013CSMD1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN014CSMD1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN082CUL3 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN083CUL3 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN234CYFIP1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN235CYFIP1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN060CYP26B1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN061CYP26B1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN062DFNA5 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN063DFNA5 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN064DGKI (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN065DGKI (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN170DLGAP1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN171DLGAP1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN066DPP4 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN067DPP4 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN174DYRK1A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN175DYRK1A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN072EPC2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN073EPC2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN262EPHX2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN263EPHX2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN084FANCL (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN085FANCL (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN086FES (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN087FES (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN088FURIN (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN089FURIN (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN264FUT9 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN265FUT9 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN003FXR1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN004FXR1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN090GALNT10 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN091GALNT10 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN094GRIN2A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN095GRIN2A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN224GRM3 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN225GRM3 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN098HCN1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN099HCN1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN176IDO2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN177IDO2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN102IMMP2L (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN103IMMP2L (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN268KCNB1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN269KCNB1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN104KCTD13 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN105KCTD13 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN106KDM4A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN107KDM4A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN130MAD1L1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN131MAD1L1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN112MAN2A1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN113MAN2A1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN196MEF2C (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN197MEF2C (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN272MMP16 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN273MMP16 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN118MPP6 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN119MPP6 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN276PLCH2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN277PLCH2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN135SATB2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN125PPP1R16B (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN128PTGIS (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN129PTGIS (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN278PTN (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN279PTN (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN204PTPRF (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN205PTPRF (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN206RERE (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN207RERE (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN280RIMS1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN281RIMS1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN134SATB2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN124PPP1R16B (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN017SCN2A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN018SCN2A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN282SDCCAG8 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN283SDCCAG8 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN021SHANK3 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN022SHANK3 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN286SLC45A1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN287SLC45A1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN023SYNGAP1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN024SYNGAP1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN144TBC1D5 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN145TBC1D5 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN216TLE1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN217TLE1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN218TLE3 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN219TLE3 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN150TSNARE1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN151TSNARE1 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN220VRK2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN221VRK2 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN154ZNF536 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN155ZNF536 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN156ZNF804A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN157ZNF804A (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN158ZSWIM6 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pPN159ZSWIM6 (Homo sapiens)CRISPR Barrett A Scaled Framework for CRISPR Editing of Human Pluripotent Stem Cells to Study Psychiatric Disease. Stem Cell Reports. 2017 Oct 10;9(4):1315-1327. doi: 10.1016/j.stemcr.2017.09.006.
pMonAID_dCas9-PmCDA_Hyg_ALSSpCas9 (Other)Plant Expression Kondo Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion. Nat Biotechnol. 2017 Mar 27. doi: 10.1038/nbt.3833.
pMonAID_nCas9-PmCDA_Hyg_ALSSpCas9 (Other)Plant Expression Kondo Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion. Nat Biotechnol. 2017 Mar 27. doi: 10.1038/nbt.3833.
pDicAID_nCas9-PmCDA_NptII_DellaSpCas9 (Other)Plant Expression Kondo Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion. Nat Biotechnol. 2017 Mar 27. doi: 10.1038/nbt.3833.
pDicAID_nCas9-PmCDA-2A-NptII_ETRSpCas9 (Other)Plant Expression Kondo Targeted base editing in rice and tomato using a CRISPR-Cas9 cytidine deaminase fusion. Nat Biotechnol. 2017 Mar 27. doi: 10.1038/nbt.3833.
pADH118-17NAT 2of2, pSNR52, C. albicans URA3-specific gRNA, LEU2 2of2 Hernday An efficient, rapid, and recyclable system for CRISPR-mediated genome editing in Candida albicans mSphere Apr 2017, 2 (2) e00149-17
pX330A-nBRD4/PITChSpCas9 (Synthetic)Mammalian Expression, CRISPR Bradner The dTAG system for immediate and target-specific protein degradation Nature Chemical Biology (2018)
AOI-WT-Cas9-sg-mouse Gfi1-exon4(F2)-GFPgRNA targeting Gfi1 (Mus musculus)Mammalian Expression, CRISPR Roussel Inactivation of Ezh2 Upregulates Gfi1 and Drives Aggressive Myc-Driven Group 3 Medulloblastoma. Cell Rep. 2017 Mar 21;18(12):2907-2917. doi: 10.1016/j.celrep.2017.02.073.
AOI-WT-Cas9-sg-mouse Ezh2-E10-GFPgRNA targeting Ezh2 (Mus musculus)Mammalian Expression, CRISPR Roussel Inactivation of Ezh2 Upregulates Gfi1 and Drives Aggressive Myc-Driven Group 3 Medulloblastoma. Cell Rep. 2017 Mar 21;18(12):2907-2917. doi: 10.1016/j.celrep.2017.02.073.
AOI-WT-Cas9-sg-mouse Ezh2-E18-GFPgRNA targeting Ezh2 (Mus musculus)Mammalian Expression, CRISPR Roussel Inactivation of Ezh2 Upregulates Gfi1 and Drives Aggressive Myc-Driven Group 3 Medulloblastoma. Cell Rep. 2017 Mar 21;18(12):2907-2917. doi: 10.1016/j.celrep.2017.02.073.
AOI-WT-Cas9-sg-mouse Suz12-F1-GFPgRNA targeting Suz12 (Mus musculus)Mammalian Expression, CRISPR Roussel Inactivation of Ezh2 Upregulates Gfi1 and Drives Aggressive Myc-Driven Group 3 Medulloblastoma. Cell Rep. 2017 Mar 21;18(12):2907-2917. doi: 10.1016/j.celrep.2017.02.073.
AOI-WT-Cas9-sg-mouse Suz12-F2-GFPgRNA targeting Suz12 (Mus musculus)Mammalian Expression, CRISPR Roussel Inactivation of Ezh2 Upregulates Gfi1 and Drives Aggressive Myc-Driven Group 3 Medulloblastoma. Cell Rep. 2017 Mar 21;18(12):2907-2917. doi: 10.1016/j.celrep.2017.02.073.
AOI-WT-Cas9-sg-mouse Gfi1-exon4(F1)-GFPgRNA targeting Gfi1 (Mus musculus)Mammalian Expression, CRISPR Roussel Inactivation of Ezh2 Upregulates Gfi1 and Drives Aggressive Myc-Driven Group 3 Medulloblastoma. Cell Rep. 2017 Mar 21;18(12):2907-2917. doi: 10.1016/j.celrep.2017.02.073.
AOI-WT-Cas9-sg-mouse Gfi1-exon5 (F3)-GFPgRNA targeting Gfi1 (Mus musculus)Mammalian Expression, CRISPR Roussel Inactivation of Ezh2 Upregulates Gfi1 and Drives Aggressive Myc-Driven Group 3 Medulloblastoma. Cell Rep. 2017 Mar 21;18(12):2907-2917. doi: 10.1016/j.celrep.2017.02.073.
lentiCRISPR.sgKras.9Kras sgRNA (Mus musculus)Lentiviral Xue Genetic disruption of oncogenic Kras sensitizes lung cancer cells to Fas receptor-mediated apoptosis. Proc Natl Acad Sci U S A. 2017 Apr 4;114(14):3648-3653. doi: 10.1073/pnas.1620861114. Epub 2017 Mar 20.
pAAV-U6-CB2gRNA-CBh-mCherrymCherry (Synthetic)AAV Kim Distinct roles of neuronal and microglial CB2 cannabinoid receptors in the mouse hippocampus. Neuroscience. 2017 Sep 6. pii: S0306-4522(17)30629-2. doi: 10.1016/j.neuroscience.2017.08.053.
pLQ-Pxyl/tet-cas9-Pj23119-sgRNACas9-Pxyltet-sgRNA-pj23119 (Other)Bacterial Expression, CRISPR Yang Sheng lab CRISPR plasmids (unpublished)
pX330-EN1201spCas9-nuclease and sgRNA against mouse TIGRE acceptor locusMammalian Expression Bruneau Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization. Cell. 2017 May 18;169(5):930-944.e22. doi: 10.1016/j.cell.2017.05.004.
lentiGuide-RRBP1-1RRBP1 sgRNA-1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Ting Proteomic mapping of cytosol-facing outer mitochondrial and ER membranes in living human cells by proximity biotinylation. Elife. 2017 Apr 25;6. pii: e24463. doi: 10.7554/eLife.24463.
lentiGuide-RRBP1-2RRBP1 sgRNA-2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Ting Proteomic mapping of cytosol-facing outer mitochondrial and ER membranes in living human cells by proximity biotinylation. Elife. 2017 Apr 25;6. pii: e24463. doi: 10.7554/eLife.24463.
lentiGuide-SYNJ2BP-1SYNJ2BP sgRNA-1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Ting Proteomic mapping of cytosol-facing outer mitochondrial and ER membranes in living human cells by proximity biotinylation. Elife. 2017 Apr 25;6. pii: e24463. doi: 10.7554/eLife.24463.
lentiGuide-SYNJ2BP-2SYNJ2BP sgRNA-2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Ting Proteomic mapping of cytosol-facing outer mitochondrial and ER membranes in living human cells by proximity biotinylation. Elife. 2017 Apr 25;6. pii: e24463. doi: 10.7554/eLife.24463.
CMV-sgE1TSS-short-3'boxEvx1as short isoform (Mus musculus)CRISPR Shen Divergent lncRNAs Regulate Gene Expression and Lineage Differentiation in Pluripotent Cells. Cell Stem Cell. 2016 May 5;18(5):637-52. doi: 10.1016/j.stem.2016.01.024. Epub 2016 Mar 17.
pLenti_dCas9-2xAM_hIRF-1Sp-dCas9-2xAM tag (Synthetic), gRNA targeting human IRF-1 promoter (Synthetic)Mammalian Expression, Lentiviral, CRISPR Fujii enChIP systems using different CRISPR orthologues and epitope tags. BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-3262-4.
VE-cad KI gRNA1VEcad KI gRNA1 (Homo sapiens)Mammalian Expression, CRISPR Palecek Human pluripotent stem cell-derived epicardial progenitors can differentiate to endocardial-like endothelial cells Bioeng. Transl. Med. (2017). 2: 191–201.
VE-cad KI gRNA2VEcad KI gRNA2 (Homo sapiens)Mammalian Expression, CRISPR Palecek Human pluripotent stem cell-derived epicardial progenitors can differentiate to endocardial-like endothelial cells Bioeng. Transl. Med. (2017). 2: 191–201.
WT1 KI gRNA1WT1 (Homo sapiens)Mammalian Expression Palecek Long-term self-renewing human epicardial cells generated from pluripotent stem cells under defined xeno-free conditions. Nat Biomed Eng. 2016;1. pii: 0003. doi: 10.1038/s41551-016-0003. Epub 2016 Dec 5.
WT1 KI gRNA2WT1 (Homo sapiens)Mammalian Expression Palecek Long-term self-renewing human epicardial cells generated from pluripotent stem cells under defined xeno-free conditions. Nat Biomed Eng. 2016;1. pii: 0003. doi: 10.1038/s41551-016-0003. Epub 2016 Dec 5.
pIKU801-CrPEPC1sgRNA-CrPEPC1 (Synthetic)Plant Expression, CRISPR Ng CRISPRi mediated phosphoenolpyruvate carboxylase regulation to enhance the production of lipid in Chlamydomonas reinhardtii. Bioresour Technol. 2017 May 4. pii: S0960-8524(17)30619-3. doi: 10.1016/j.biortech.2017.04.111.
pSpCas9(BB)-2A-Puro-Exon4-PAFAH1B1PAFAH1B1 (Homo sapiens)Mammalian Expression, CRISPR Leisegang PAFAH1B1 and the lncRNA NONHSAT073641 maintain an angiogenic phenotype in human endothelial cells. Acta Physiol (Oxf). 2016 Apr 28. doi: 10.1111/apha.12700.
pSpCas9(BB)-2A-Intron4-PAFAH1B1PAFAH1B1 (Homo sapiens)Mammalian Expression, CRISPR Leisegang PAFAH1B1 and the lncRNA NONHSAT073641 maintain an angiogenic phenotype in human endothelial cells. Acta Physiol (Oxf). 2016 Apr 28. doi: 10.1111/apha.12700.
pX330-NEAT1pr_v1sgRNA NEAT1pr_v1 (Homo sapiens)CRISPR Fox Functional dissection of NEAT1 using genome editing reveals substantial localisation of the NEAT1_1 isoform outside paraspeckles. RNA. 2017 Mar 21. pii: rna.059477.116. doi: 10.1261/rna.059477.116.
pX330-NEAT1pr_v2sgRNA NEAT1pr_v2 (Homo sapiens)CRISPR Fox Functional dissection of NEAT1 using genome editing reveals substantial localisation of the NEAT1_1 isoform outside paraspeckles. RNA. 2017 Mar 21. pii: rna.059477.116. doi: 10.1261/rna.059477.116.
pX330-NEAT1m_v1sgRNA NEAT1m_v1 (Homo sapiens)CRISPR Fox Functional dissection of NEAT1 using genome editing reveals substantial localisation of the NEAT1_1 isoform outside paraspeckles. RNA. 2017 Mar 21. pii: rna.059477.116. doi: 10.1261/rna.059477.116.
pX330-GFP-SFPQsgRNA GFP-SFPQ (Homo sapiens)CRISPR Fox Functional dissection of NEAT1 using genome editing reveals substantial localisation of the NEAT1_1 isoform outside paraspeckles. RNA. 2017 Mar 21. pii: rna.059477.116. doi: 10.1261/rna.059477.116.
pX335-NEAT1_IS_v1sgRNA NEAT1_IS_v1 (Homo sapiens)CRISPR Fox Functional dissection of NEAT1 using genome editing reveals substantial localisation of the NEAT1_1 isoform outside paraspeckles. RNA. 2017 Mar 21. pii: rna.059477.116. doi: 10.1261/rna.059477.116.
pX335-NEAT1_IS_v2sgRNA NEAT1_IS_v2 (Homo sapiens)CRISPR Fox Functional dissection of NEAT1 using genome editing reveals substantial localisation of the NEAT1_1 isoform outside paraspeckles. RNA. 2017 Mar 21. pii: rna.059477.116. doi: 10.1261/rna.059477.116.
AAV_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyAActb HMEJ donor (Synthetic)Mammalian Expression, Mouse Targeting, AAV Yang Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76.
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyAActb HR donor (Synthetic)Mammalian Expression, Mouse Targeting, AAV Yang Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76.
AAV_Actb NHEJ donor_U6_sgRNA_EF1a_GFP_polyAActb NHEJ donor (Synthetic)Mammalian Expression, Mouse Targeting, AAV Yang Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76.
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyAActb MMEJ donor (Synthetic)Mammalian Expression, Mouse Targeting, AAV Yang Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76.
Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyAActb HMEJ donor (Synthetic)Mammalian Expression, Mouse Targeting, Lentiviral Yang Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76.
hIRF-1 gRNA #409 (Sa)gRNA_hIRF1 promoter #409 (Homo sapiens)Mammalian Expression, CRISPR Fujii enChIP systems using different CRISPR orthologues and epitope tags. BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-3262-4.
pYZ033CRISPR, Synthetic Biology Boeke Construction of Designer Selectable Marker Deletions with CRISPR-Cas9 Toolbox in Schizosaccharomyces pombe and Optimized Design of Common Entry Vectors. G3 (Bethesda). 2018 Jan 10. pii: g3.117.300363. doi: 10.1534/g3.117.300363.
pYZ146gRNA targeting Sp.leu1 (Schizosaccharomyces pombe)CRISPR Boeke Construction of Designer Selectable Marker Deletions with CRISPR-Cas9 Toolbox in Schizosaccharomyces pombe and Optimized Design of Common Entry Vectors. G3 (Bethesda). 2018 Jan 10. pii: g3.117.300363. doi: 10.1534/g3.117.300363.
pYZ164gRNA targeting Sp.his3 (Schizosaccharomyces pombe)CRISPR Boeke Construction of Designer Selectable Marker Deletions with CRISPR-Cas9 Toolbox in Schizosaccharomyces pombe and Optimized Design of Common Entry Vectors. G3 (Bethesda). 2018 Jan 10. pii: g3.117.300363. doi: 10.1534/g3.117.300363.
pYZ173gRNA targeting Sp.lys9 (Schizosaccharomyces pombe)CRISPR Boeke Construction of Designer Selectable Marker Deletions with CRISPR-Cas9 Toolbox in Schizosaccharomyces pombe and Optimized Design of Common Entry Vectors. G3 (Bethesda). 2018 Jan 10. pii: g3.117.300363. doi: 10.1534/g3.117.300363.
gRNA-CXCR4(90)CXCR4 (Homo sapiens)Mammalian Expression, CRISPR Procko Mapping Interaction Sites on Human Chemokine Receptors by Deep Mutational Scanning. J Immunol. 2018 Apr 20. pii: jimmunol.1800343. doi: 10.4049/jimmunol.1800343.
pUC CBA-SpCas9.EF1a-BFP.sgLMNALMNA sgRNA and spCas9 (Homo sapiens)Mammalian Expression Karlseder Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature. 2017 Sep 20;549(7673):548-552. doi: 10.1038/nature24023.
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair1LMNA sgRNAs pair 1 and Cas9(D10A) (Homo sapiens)Mammalian Expression Karlseder Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature. 2017 Sep 20;549(7673):548-552. doi: 10.1038/nature24023.
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair2LMNA sgRNAs pair 2 and Cas9(D10A) (Homo sapiens)Mammalian Expression Karlseder Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature. 2017 Sep 20;549(7673):548-552. doi: 10.1038/nature24023.
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair3LMNA sgRNAs pair 3 and Cas9(D10A) (Homo sapiens)Mammalian Expression Karlseder Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature. 2017 Sep 20;549(7673):548-552. doi: 10.1038/nature24023.
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair4LMNA sgRNAs pair 4 and Cas9(D10A) (Homo sapiens)Mammalian Expression Karlseder Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature. 2017 Sep 20;549(7673):548-552. doi: 10.1038/nature24023.
pUC CBA-SpCas9N863Anickase.EF1a-BFP.sgLMNApair1LMNA sgRNAs pair 1 and Cas9(N863A) (Homo sapiens)Mammalian Expression Karlseder Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature. 2017 Sep 20;549(7673):548-552. doi: 10.1038/nature24023.
U6.3>Control.gRNA.f+eControl gRNACRISPR Bronner Optimization of CRISPR/Cas9 genome editing for loss-of-function in the early chick embryo. Dev Biol. 2017 Dec 1;432(1):86-97. doi: 10.1016/j.ydbio.2017.08.036.
LentiCRISPRv2-ATG5gRNA targeting ATG5 (Homo sapiens)Mammalian Expression, Lentiviral Campbell TRIM5alpha degradation via autophagy is not required for retroviral restriction. J Virol. 2016 Jan 13. pii: JVI.03033-15.
LentiCRISPRv2-Beclin1gRNA targeting Beclin1 (Homo sapiens)Mammalian Expression, Lentiviral Campbell TRIM5alpha degradation via autophagy is not required for retroviral restriction. J Virol. 2016 Jan 13. pii: JVI.03033-15.
Icam 2 SaCas9 YAP sgRNA1SaCas9 gRNA targeting Yap1 (Mus musculus)Mammalian Expression, AAV, CRISPR Huang Integrin-YAP/TAZ-JNK cascade mediates atheroprotective effect of unidirectional shear flow. Nature. 2016 Dec 7. doi: 10.1038/nature20602.
Icam 2 SaCas9 YAP sgRNA2SaCas9 gRNA targeting Yap1 (Mus musculus)Mammalian Expression, AAV, CRISPR Huang Integrin-YAP/TAZ-JNK cascade mediates atheroprotective effect of unidirectional shear flow. Nature. 2016 Dec 7. doi: 10.1038/nature20602.
Icam 2 SaCas9 YAP sgRNA3SaCas9 gRNA targeting Yap1 (Mus musculus)Mammalian Expression, AAV, CRISPR Huang Integrin-YAP/TAZ-JNK cascade mediates atheroprotective effect of unidirectional shear flow. Nature. 2016 Dec 7. doi: 10.1038/nature20602.
AAV-KrasWT/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG12A/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG12C/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG12D/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG12R/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG12S/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG12V/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG13A/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG13C/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG13D/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG13R/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG13S/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AAV-KrasG13V/sgKras/CreKras (Mus musculus)Mammalian Expression, AAV, Cre/Lox Winslow Multiplexed in vivo homology-directed repair and tumor barcoding enables parallel quantification of Kras variant oncogenicity Nature Communications 8: 2053 (2017)
AL08_pgRNA.DMDgRNA spacer (Homo sapiens)Mammalian Expression, CRISPR, Synthetic Biology Goncalves In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting. Nature Communications
AY22_pgRNA.R5.1gRNA spacer (Homo sapiens)Mammalian Expression, CRISPR, Synthetic Biology Goncalves In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting. Nature Communications
AY23_pgRNA.R5.2gRNA spacer (Homo sapiens)Mammalian Expression, CRISPR, Synthetic Biology Goncalves In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting. Nature Communications
pSLQ1651-sgRNA(F+E)-sgGal4sgGal4 (Other)Mammalian Expression, CRISPR Xu In Situ Capture of Chromatin Interactions by Biotinylated dCas9. Cell. 2017 Aug 24;170(5):1028-1043.e19. doi: 10.1016/j.cell.2017.08.003.
AAVS1_sgRNAAAVS1 sgRNA Maly Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368.
EMX1_sgRNAEMX1 sgRNA Maly Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368.
MYC sgRNA4MYC sgRNA4 Maly Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368.
MYC sgRNA5MYC sgRNA5 Maly Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368.
EMX1*_sgRNAEMX1 sgRNA Maly Rapidly inducible Cas9 and DSB-ddPCR to probe editing kinetics. Nat Methods. 2017 Jul 24. doi: 10.1038/nmeth.4368.
hgRNA-A21_pLKO-HyghgRNA-A21Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
hgRNA-B21_pLKO-HyghgRNA-B21Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
hgRNA-C21_pLKO-HyghgRNA-C21Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
hgRNA-D21_pLKO-HyghgRNA-D21Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
hgRNA-E21_pLKO-HyghgRNA-E21Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
hgRNA-F21_pLKO-HyghgRNA-F21Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
hgRNA-G21_pLKO-HyghgRNA-G21Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
hgRNA-A26_pLKO-HyghgRNA-A26Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
hgRNA-A51_pLKO-HyghgRNA-A51Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
hgRNA-A76_pLKO-HyghgRNA-A76Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
hgRNA-A101_pLKO-HyghgRNA-A101Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
hgRNA-A21_pLKO-PurohgRNA-A21Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
FISSEQ-hgRNA-Design1FISSEQ-hgRNA-Design1Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
FISSEQ-hgRNA-Design2FISSEQ-hgRNA-Design2Mammalian Expression, Lentiviral, CRISPR, Synthetic Biology Church Rapidly evolving homing CRISPR barcodes. Nat Methods. 2017 Feb;14(2):195-200. doi: 10.1038/nmeth.4108. Epub 2016 Dec 5.
B52 + SPRTN sgSTOPsgSTOP targeting SPRTN (cloned using BbsI) (Homo sapiens)Mammalian Expression, CRISPR Ciccia CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008.
B52 + FANCM sgSTOPsgSTOP targeting FANCM (cloned using BbsI) (Homo sapiens)Mammalian Expression, CRISPR Ciccia CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008.
B52 + PARP4 sgSTOPsgSTOP targeting PARP4 (cloned using BbsI) (Homo sapiens)Mammalian Expression, CRISPR Ciccia CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008.
B52 + CHEK2 sgSTOPsgSTOP targeting CHEK2 (cloned using BbsI) (Homo sapiens)Mammalian Expression, CRISPR Ciccia CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008.
B52 + TIMELESS sgSTOPsgSTOP targeting TIMELESS (cloned using BbsI) (Homo sapiens)Mammalian Expression, CRISPR Ciccia CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008.
B52 + PIK3R1 sgSTOPsgSTOP targeting PIK3R1 (cloned using BbsI) (Homo sapiens)Mammalian Expression, CRISPR Ciccia CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008.
B52 + SMARCAL1 sgSTOPsgSTOP targeting SMARCAL1 (cloned using BbsI) (Homo sapiens)Mammalian Expression, CRISPR Ciccia CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008.
B270 (plasmid expressing ATP1A1 sgSTOP and containing an empty sgRNA-expression cassette)sgSTOP targeting ATP1A1 (cloned using BsmBI) (Homo sapiens)Mammalian Expression, CRISPR Ciccia CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons. Mol Cell. 2017 Sep 4. pii: S1097-2765(17)30605-6. doi: 10.1016/j.molcel.2017.08.008.
PX458_RERE_1gRNA against RERE (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KMT2B_1gRNA against KMT2B (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_KMT2B_2gRNA against KMT2B (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_AHR_1gRNA against AHR (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_AHR_2gRNA against AHR (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
PX458_ARID4B_1gRNA against ARID4B (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9.
sg2.02 MUC4.1MUC4 (Homo sapiens)Lentiviral, CRISPR Adli Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9. Nat Commun. 2017 Mar 14;8:14725. doi: 10.1038/ncomms14725.
sg14x(MS2) MUC4.1MUC4 (Homo sapiens)Lentiviral, CRISPR Adli Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9. Nat Commun. 2017 Mar 14;8:14725. doi: 10.1038/ncomms14725.
sg2.02 16x(MS2) MUC4.1MUC4 (Homo sapiens)Lentiviral, CRISPR Adli Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9. Nat Commun. 2017 Mar 14;8:14725. doi: 10.1038/ncomms14725.
sg2.0 (PP7) Locus#2Locus #2(tandem repeat) (Homo sapiens)Lentiviral, CRISPR Adli Live cell imaging of low- and non-repetitive chromosome loci using CRISPR-Cas9. Nat Commun. 2017 Mar 14;8:14725. doi: 10.1038/ncomms14725.
pUDP010HH-gRNA-HDV targetting SeILV6 in S. pastorianus (Saccharomyces cerevisiae)Yeast Expression, CRISPR Daran CRISPR-Cas9 mediated gene deletions in lager yeast Saccharomyces pastorianus. Microb Cell Fact. 2017 Dec 5;16(1):222. doi: 10.1186/s12934-017-0835-1.
pUDP012HH-gRNA-HDV targetting SeILV6 in S. pastorianus (Saccharomyces cerevisiae)Yeast Expression, CRISPR Daran CRISPR-Cas9 mediated gene deletions in lager yeast Saccharomyces pastorianus. Microb Cell Fact. 2017 Dec 5;16(1):222. doi: 10.1186/s12934-017-0835-1.
pUDP044polycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting SeATF1 and 2 in S. pastorianus (Saccharomyces cerevisiae)Yeast Expression, CRISPR Daran CRISPR-Cas9 mediated gene deletions in lager yeast Saccharomyces pastorianus. Microb Cell Fact. 2017 Dec 5;16(1):222. doi: 10.1186/s12934-017-0835-1.
pCRRNA-G0-R0crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G10-R0crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G11-R0crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G14-R0crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G20-R0crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G0-R11crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G10-R11crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G11-R11crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G14-R11crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G20-R11crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G0-R18crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G10-R18crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G11-R18crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G14-R18crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G20-R18crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G0-R20crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G10-R20crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G11-R20crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G14-R20crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
pCRRNA-G20-R20crRNAs targeting GFP and mCherry (Synthetic)CRISPR, Synthetic Biology Bikard Tuning dCas9's ability to block transcription enables robust, noiseless knockdown of bacterial genes. Mol Syst Biol. 2018 Mar 8;14(3):e7899.
Adeno BNU6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)_CBh_FLAG-Cas9 (Mus musculus)Adenoviral Ventura Somatic chromosomal engineering identifies BCAN-NTRK1 as a potent glioma driver and therapeutic target. Nat Commun. 2017 Jul 11;8:15987. doi: 10.1038/ncomms15987.
Adeno FTU6_sgRNA(Fgfr3)_U6_sgRNA(Tacc3)_CBh_FLAG-Cas9 (Mus musculus)Adenoviral Ventura Somatic chromosomal engineering identifies BCAN-NTRK1 as a potent glioma driver and therapeutic target. Nat Commun. 2017 Jul 11;8:15987. doi: 10.1038/ncomms15987.
lentiCRISPRv2-TTF-1-gRNAgRNA targeting TTF-1 (Homo sapiens)Lentiviral Mu Thyroid transcription factor 1 enhances cellular statin sensitivity via perturbing cholesterol metabolism. Oncogene. 2018 Mar 19. pii: 10.1038/s41388-018-0174-7. doi: 10.1038/s41388-018-0174-7.
WPXL SOX10 gRNASOX10 promoter targeting gRNA (Homo sapiens)Lentiviral Huangfu TET proteins safeguard bivalent promoters from de novo methylation in human embryonic stem cells. Nat Genet. 2018 Jan;50(1):83-95. doi: 10.1038/s41588-017-0002-y. Epub 2017 Dec 4.
WPXL LEFTY2 gRNALEFTY2 enhancer targeting gRNA (Homo sapiens)Lentiviral Huangfu TET proteins safeguard bivalent promoters from de novo methylation in human embryonic stem cells. Nat Genet. 2018 Jan;50(1):83-95. doi: 10.1038/s41588-017-0002-y. Epub 2017 Dec 4.
pKDsgRNA-pfkBpfkB gRNA (Other)Bacterial Expression, CRISPR Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-fsaAfsaA gRNABacterial Expression, CRISPR Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-ldhAldhA gRNABacterial Expression, CRISPR Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-adhEadhE gRNABacterial Expression, CRISPR Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pKDsgRNA-ompTompT gRNABacterial Expression, CRISPR Lynch Managing the SOS Response for Enhanced CRISPR-Cas-Based Recombineering in E. coli through Transient Inhibition of Host RecA Activity. ACS Synth Biol. 2017 Oct 2. doi: 10.1021/acssynbio.7b00174.
pLCRISPR-CMV-cGAS3gRNA targeting human cGAS (Homo sapiens)Mammalian Expression, Lentiviral Manel Transmission of innate immune signaling by packaging of cGAMP in viral particles. Science. 2015 Sep 11;349(6253):1232-6. doi: 10.1126/science.aab3628. Epub 2015 Jul 30.
sgp27#1p27 (Mus musculus)Mammalian Expression, Lentiviral Chen Targeting EphA2 impairs cell cycle progression and growth of basal-like/triple-negative breast cancers. Oncogene. 2017 Jun 5. doi: 10.1038/onc.2017.170.
U6-hGRIN2B-CAG-ps-SpCas9sp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1 (Homo sapiens)Mammalian Expression, CRISPR Lin A Single-Chain Photoswitchable CRISPR-Cas9 Architecture for Light-Inducible Gene Editing and Transcription. ACS Chem Biol. 2017 Sep 29. doi: 10.1021/acschembio.7b00603.
U6-hGRIN2B-CAG-ps-SaCas9sa-hGRIN2B-sgRNA; dSaCas9; pdDronpa1 (Homo sapiens)Mammalian Expression, CRISPR Lin A Single-Chain Photoswitchable CRISPR-Cas9 Architecture for Light-Inducible Gene Editing and Transcription.