This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CRISPR header icon CRISPR/Cas Plasmids: Validated gRNA Plasmids


The table below lists experimentally validated gRNA plasmids designed to target various genes or genomic regions. It is highly recommended that you determine if your cell type contains the target sequence before using any of these gRNA plasmids and review the publication associated with each plasmid for more information on how it was originally used.

Do you have validated gRNAs you'd like to add to the Addgene collection? Click here to start the deposit process and have your plasmids added to the list. You can also email [email protected] for more information and assistance with the deposit process!


Validated gRNA Plasmids

Plasmid Gene/Insert Vector Type PI Publication Hidden Extra Search Info  
gRNA_AAVS1-T1gRNA_AAVS1-T1Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target human AAVS1 (T1 target sequence) for genome engineering pCR-Blunt II-TOPO Add to Cart
gRNA_AAVS1-T2gRNA_AAVS1-T2Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target human AAVS1 (T2 target sequence) for genome engineering pCR-Blunt II-TOPO Add to Cart
gRNA_GFP-T1gRNA_GFP-T1Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target GFP (T1 target sequence) for genome engineering pCR-Blunt II-TOPO Add to Cart
gRNA_GFP-T2gRNA_GFP-T2Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target GFP (T2 target sequence) for genome engineering pCR-Blunt II-TOPO Add to Cart
gRNA_DNMT3a-T1gRNA_DNMT3a-T1 (Homo sapiens)Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target DNMT3a (T1 target sequence) for genome engineering pCR-Blunt II-TOPO DNMT3A DNMT3A2, M.HsaIIIA, TBRS Add to Cart
gRNA_DNMT3a-T2gRNA_DNMT3a-T2 (Homo sapiens)Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target DNMT3a (T2 target sequence) for genome engineering pCR-Blunt II-TOPO DNMT3A DNMT3A2, M.HsaIIIA, TBRS Add to Cart
gRNA_DNMT3bgRNA_DNMT3b (Homo sapiens)Mammalian Expression, CRISPR Church RNA-Guided Human Genome Engineering via Cas9. Science. 2013 Jan 3. Expresses a guide RNA (gRNA) to target DNMT3b for genome engineering pCR-Blunt II-TOPO DNMT3B ICF, ICF1, M.HsaIIIB Add to Cart
Zebrafish-gRNA-0001gRNA-apoea (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. DR274 apoea im:7036787, wu:fb69a05, zgc:110064 Add to Cart
Zebrafish-gRNA-0002gRNA-drd3 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. DR274 drd3 Add to Cart
Zebrafish-gRNA-0003gRNA-fh site #1 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. DR274 fh Fh1, im:7152785, ns:zf-e152, zf-e152, zgc:66253, zgc:77498 Add to Cart
Zebrafish-gRNA-0004gRNA-fh site #2 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. DR274 fh Fh1, im:7152785, ns:zf-e152, zf-e152, zgc:66253, zgc:77498 Add to Cart
Zebrafish-gRNA-0005gRNA-gsk3b (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. DR274 gsk3b GSK-3[b], GSK3, fk80d11, wu:fb68h05, wu:fk80d11 Add to Cart
Zebrafish-gRNA-0006gRNA-rgs4 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. DR274 rgs4 cb436, sb:cb436, wu:fc06d08 Add to Cart
Zebrafish-gRNA-0007gRNA-th1 (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. DR274 th Add to Cart
Zebrafish-gRNA-0008gRNA-tia1l (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. DR274 tia1l TIA1, fb98f09, wu:fb98f09, zgc:55893, zgc:76917 Add to Cart
Zebrafish-gRNA-0009gRNA-tph1a (Danio rerio)CRISPR ; zebrafish expression Joung Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2501. DR274 tph1a tph, tph1, tphD1 Add to Cart
pX261-U6-DR-hEmx1-DR-Cbh-NLS-hSpCas9-NLS-H1-shorttracr-PGK-purohumanized S. pyogenes Cas9Mammalian Expression, CRISPR Zhang Multiplex Genome Engineering Using CRISPR/Cas Systems. Science. 2013 Jan 3. Dual expression plasmid of human codon-optimized SpCas9 and a gRNA to the human Emx1 locus, can be used to test SpCas9 cleavage in cell lines of choice. pUC ori vector
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)
  • Add to Cart
    p426-SNR52p-gRNA.CAN1.Y-SUP4tCAN1.y gRNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR Church Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res Encodes a gRNA that targets Can1.Y in yeast. p426 CAN1 YEL063C Add to Cart
    pCRISPR::rpsLCRISPR::rpsLCRISPR ; E.coli Marraffini RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2508. A crRNA expression plasmid specific to the rpsL allele. pZE21-MCS1 rpsL b3342, ECK3329, JW3304, asuB, strA Add to Cart
    PU6::unc-119_sgRNAunc-119 targeting sgRNA (Synthetic)CRISPR Calarco Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532. pUC57 unc-119 CELE_M142.1 Add to Cart
    PU6::klp-12_sgRNAklp-12 targeting sgRNA (Synthetic)Worm Expression, CRISPR Calarco Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013 Jun 30. doi: 10.1038/nmeth.2532. pUC57 klp-12 CELE_T01G1.1a Add to Cart
    pT7EGFPgRNAegfp target (Synthetic)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5. pT7-gRNA Add to Cart
    pT7tyrgRNAtyr gRNA (Danio rerio)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5. pT7-gRNA tyr sandy, zgc:109705 Add to Cart
    pU6-sgGFP-NT1sgGFP-NT1Mammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1) pSICO derivative Add to Cart
    pU6-sgGAL4-1sgGAL4-1, Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter pSICO derivative Add to Cart
    pU6-sgGAL4-4sgGAL4-4, Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter (negative control) pSICO derivative Add to Cart
    pU6-sgCXCR4-2sgCXCR4 -2 (Homo sapiens), Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous CXCR4 gene pSICO derivative CXCR4 CD184, D2S201E, FB22, HM89, HSY3RR, LAP-3, LAP3, LCR1, LESTR, NPY3R, NPYR, NPYRL, NPYY3R, WHIM, WHIMS Add to Cart
    pU6-sgCD71-2sgCD71 -2 (Homo sapiens), Puromycin resistance and mCherryMammalian Expression, Lentiviral, CRISPR Qi CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting endogenous CD71 gene pSICO derivative TFRC CD71, IMD46, T9, TFR, TFR1, TR, TRFR, p90 Add to Cart
    pSNR52-sgTEF1sgTEF1 promoter (Saccharomyces cerevisiae)Yeast Expression, CRISPR Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Yeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TEF1 promoter AH057 TEF1 YPR080W Add to Cart
    pSNR52-sgTETsgRNA targeting endogenous TRE elements of pTET07 promoter (Saccharomyces cerevisiae)Yeast Expression, CRISPR Weissman CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. Yeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoter AH057 Add to Cart
    pICH86966::AtU6p::sgRNA_PDSAtU6p::sgRNA_PDS (Synthetic)CRISPR ; Plant expression Kamoun Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA-guided endonuclease. Nat Biotechnol. 2013 Aug 8;31(8):691-3. doi: 10.1038/nbt.2655. Expresses an sgRNA targeting the PDS gene in Nicotiana benthamiana from the Arabidopsis U6 promoter pICH86966 Add to Cart
    pVC297 VEGF Site#1gRNA-VEGF site 1 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. human gRNA expression vector targeting VEGF MLM3636 Add to Cart
    pVC299 VEGF Site#2gRNA-VEGF site 2 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. human gRNA expression vector targeting VEGF MLM3636 Add to Cart
    pVC228 VEGF Site#3gRNA-VEGF site 3 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. human gRNA expression vector targeting VEGF MLM3636 Add to Cart
    pFYF1548 EMX1gRNA-EMX1 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. human gRNA expression vector targeting EMX1 MLM3636 Add to Cart
    pDR366 RNF2gRNA-RNF2 (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. human gRNA expression vector targeting RNF2 MLM3636 Add to Cart
    pDR348 FANCFgRNA-FANCF (Homo sapiens)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. human gRNA expression vector targeting FANCF MLM3636 Add to Cart
    pFYF1320 EGFP Site#1gRNA-EGFP site 1 (Synthetic)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. human gRNA expression vector targeting EGFP MLM3636 Add to Cart
    pFYF1327 EGFP Site#2gRNA-EGFP site 2 (Synthetic)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. human gRNA expression vector targeting EGFP MLM3636 Add to Cart
    pFYF1328 EGFP Site#3gRNA-EGFP site 3 (Synthetic)Mammalian Expression, CRISPR Joung High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013 Jun 23. doi: 10.1038/nbt.2623. human gRNA expression vector targeting EGFP MLM3636 Add to Cart
    pDD122 (Peft-3::Cas9 + ttTi5605 sgRNA)Cas9 (Synthetic), ttTi5605 sgRNA (Other)Worm Expression, CRISPR Goldstein Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nat Methods. 2013 Sep 1. doi: 10.1038/nmeth.2641. Cas9 + sgRNA plasmid that is targeted to a genomic site near the ttTi5605 Mos1 insertion allele pCFJ601 Add to Cart
    pSimpleII-U6-tracr-U6-crRNA(tdTomato)-NLS-NmCas9-HA-NLS(s)NmCas9 (Other), U6pr-tracrRNA (Other), tdTomato crRNA (Synthetic)Mammalian Expression, CRISPR Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12. All-in-one plasmid targeting tdTomato pSimpleII Add to Cart
    pSimpleII-U6-tracr-U6-crRNA(OCT4)-NLS-NmCas9-HA-NLS(s)NmCas9 (Other), U6pr-tracrRNA (Other), OCT4 crRNA (Synthetic)Mammalian Expression, CRISPR Thomson Efficient genome engineering in human pluripotent stem cells using Cas9 from Neisseria meningitidis. Proc Natl Acad Sci U S A. 2013 Aug 12. All-in-one plasmid targeting human OCT4, cuts roughly ~84bp downstream of stop codon. pSimpleII Add to Cart
    pT7goldRNAgolden gRNA (Danio rerio)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5. In vitro transcription of golden gRNA pT7-gRNA slc24a5 CH1073-436O12.1 Add to Cart
    pT7mitfagRNAmitfa gRNA (Danio rerio)CRISPR Chen Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5. in vitro transcription of mitfa gRNA pT7-gRNA mitfa nacre, z3A.1 Add to Cart
    pT7ddx19gRNAddx19 gRNA (Danio rerio)CRISPR Wente Efficient multiplex biallelic zebrafish genome editing using a CRISPR nuclease system. Proc Natl Acad Sci U S A. 2013 Aug 5. in vitro transcription of ddx19 gRNA pT7-gRNA ddx19 chunp6915, fi21a04, wu:fb24g07, wu:fc59e08, wu:fd14f03, wu:fi21a04 Add to Cart
    PM-SP!TABacterial SP crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol p15A-cat Add to Cart
    PM-SP!TBBacterial SP crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol p15A-cat Add to Cart
    PM-NM!TABacterial NM crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol p15A-cat Add to Cart
    PM-NM!TBBacterial NM crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol p15A-cat Add to Cart
    PM-ST1!TABacterial ST1 crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol p15A-cat Add to Cart
    PM-ST1!TBBacterial ST1 crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol p15A-cat Add to Cart
    PM-TD!TABacterial TD crRNA to prototspacer A (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicol p15A-cat Add to Cart
    PM-TD!TBBacterial TD crRNA to prototspacer B (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicol p15A-cat Add to Cart
    EE-SP!gIIICas9 (Other), anti-gIII tracrRNA (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Bacterial SP Cas9 targeting filamentous phage gene III at five protospacers colE1-erm Add to Cart
    M-SP-sgRNAsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter (Synthetic)CRISPR Church Orthogonal Cas9 proteins for RNA-guided gene regulation and editing. Nat Methods. 2013 Sep 29. doi: 10.1038/nmeth.2681. Mammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTG pCR-BluntII-TOPO Add to Cart
    pAc-y1sgRNA-Cas9Cas9 (Synthetic), dU6-sgRNA (Drosophila melanogaster), y1 sgRNA (Drosophila melanogaster)Insect Expression, CRISPR Liu Mutagenesis and homologous recombination in Drosophila cell lines using CRISPR/Cas9. Biol Open. 2013 Dec 10. pii: bio.20137120v1. doi: 10.1242/bio.20137120. Expresses sgRNA targeting yellow gene and Cas9-Puro in Drosophila S2 cells pAc-STABLE1-Puro y Dmel_CG3757, CG3757, Dmel\CG3757, EG:125H10.2, T6, Y Add to Cart
    pAGM4723::AtU6p::sgRNA2-2x35S-5′UTR::Cas9::NOST-AtU6p::sgRNA1sgRNA_PDS2-Cas9-sgRNA_PDS1 (Synthetic)Plant Expression, CRISPR Kamoun Plant genome editing made easy: targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods. 2013 Oct 11;9(1):39. Level 2 construct pAGM4723 Add to Cart
    pLX-sgRNAsgAAVS1Mammalian Expression, Lentiviral, CRISPR Sabatini Genetic screens in human cells using the CRISPR-Cas9 system. Science. 2014 Jan 3;343(6166):80-4. doi: 10.1126/science.1246981. Epub 2013 Dec 12. Lentiviral expression of AAVS1-targeting sgRNA; insert can be replaced with custom sgRNA (see protocol) pLX304 Add to Cart
    pX330-Cetn1/1Cetn1 sgRNA1 (Synthetic), humanized S. pyogenes Cas9 (Other)Mammalian Expression, CRISPR Ikawa Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Sci Rep. 2013 Nov 27;3:3355. doi: 10.1038/srep03355. pX330 containing sgRNA against mouse Cent1. Positive control for DSB mediated EGFP reconstitution. pX330 Add to Cart
    pLKO.1-puro U6 sgRNA Oct4A -12Oct4A -12 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. U6 driven sgRNA targeting OCT4 isoform A -12 bp from TSS pLKO.1 POU5F1 OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4 Add to Cart
    pLKO.1-puro U6 sgRNA Oct4A -158Oct4A -158 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. U6 driven sgRNA targeting OCT4 isoform A -158 bp from TSS pLKO.1 POU5F1 OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4 Add to Cart
    pLKO.1-puro U6 sgRNA SOX17 -91Sox17 -91 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. U6 driven sgRNA targeting Sox17 -91 bp from TSS pLKO.1 SOX17 VUR3 Add to Cart
    pLKO.1-puro U6 sgRNA SOX17 -126Sox17 -126 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. U6 driven sgRNA targeting Sox17 -126 bp from TSS pLKO.1 SOX17 VUR3 Add to Cart
    pLKO.1-puro U6 sgRNA SOX17 -177Sox17 -177 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. U6 driven sgRNA targeting Sox17 -177 bp from TSS pLKO.1 SOX17 VUR3 Add to Cart
    pLKO.1-puro U6 sgRNA SOX17 -296Sox17-296 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. U6 driven sgRNA targeting Sox17 -296 bp from TSS pLKO.1 SOX17 VUR3 Add to Cart
    pLKO.1-puro U6 sgRNA CAGnegative control sgRNA (Other)Mammalian Expression, Lentiviral, CRISPR Wolfe Cas9 effector-mediated regulation of transcription and differentiation in human pluripotent stem cells. Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341. U6 driven sgRNA negative control pLKO.1 Add to Cart
    pSLQ1651-sgTelomere(F+E)Optimized sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. Lentiviral vector that contains an optimized S. pyogenes sgRNA targeting human telomeres pSico Add to Cart
    pSLQ1661-sgMUC4-E3(F+E)optimized sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. Lentiviral vector that contains an optimized S. pyogenes sgRNA targeting the repetitive sequence of human MUC4 exon 3 pSico MUC4 ASGP, HSA276359, MUC-4 Add to Cart
    pRS316-RGR-GFPRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. Express self-cleaving-ribozyme-flanked sgRNA cassette (RGR) targeting GFP for CRISPR systems in yeast driven by ADH1 promoter. RGR has a HH ribozyme at its 5', and an HDV ribozyme at its 3'. pRS316 Add to Cart
    pRS316-RGR-GFP-mHHRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. Same as pRS316-RGR-GFP except for the HH ribozyme region which has a 13 bp deletion at its 5' end. pRS316 Add to Cart
    pRS316-RGR-GFP-mHDVRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. Same as pRS316-RGR-GFP except for the HDV ribozyme region which has a 15 bp deletion at its 3' end. pRS316 Add to Cart
    pRS316-RGR-GFP-mmRGR-GFP (Synthetic)Bacterial Expression, Yeast Expression, CRISPR Zhao Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing. J Integr Plant Biol. 2013 Dec 30. doi: 10.1111/jipb.12152. Same as pRS316-RGR-GFP except for the HH ribozyme region which has a 13 bp deletion at its 5' end, and for the HDV ribozyme region which has a 15 bp deletion at its 3' end. pRS316 Add to Cart
    lentiCRISPR - EGFP sgRNA 1Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 1 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR (pXPR_001), Addgene plasmid #49535 Add to Cart
    lentiCRISPR - EGFP sgRNA 2Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 2 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR (pXPR_001), Addgene plasmid #49535 Add to Cart
    lentiCRISPR - EGFP sgRNA 3Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 3 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR (pXPR_001), Addgene plasmid #49535 Add to Cart
    lentiCRISPR - EGFP sgRNA 4Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 4 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR (pXPR_001), Addgene plasmid #49535 Add to Cart
    lentiCRISPR - EGFP sgRNA 5Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 5 (Synthetic)Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR (pXPR_001), Addgene plasmid #49535 Add to Cart
    lentiCRISPR - EGFP sgRNA 6Cas9 (Synthetic), Puromycin resistance (Other), EGFP sgRNA 6 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Zhang Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 2014 Jan 3;343(6166):84-7. doi: 10.1126/science.1247005. Epub 2013 Dec 12. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR (pXPR_001), Addgene plasmid #49535 Add to Cart
    pMZ284rrk1-sgRNA (Schizosaccharomyces pombe)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Expression of sgRNA precursor targeted against ade6+ pMZ283 Add to Cart
    pMZ285rrk1-sgRNA (Schizosaccharomyces pombe)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Expression of sgRNA precursor targeted against ade6M210 pMZ283 Add to Cart
    pMZ286rrk1-sgRNA (Schizosaccharomyces pombe)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Expression of sgRNA precursor targeted against ade6L469 pMZ283 Add to Cart
    pUC119-gRNAguide RNA targeting AtPDS3 (Arabidopsis thaliana)CRISPR ; Plant expression Sheen Multiplex and homologous recombination-mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat Biotechnol. 2013 Aug;31(8):688-91. doi: 10.1038/nbt.2654. Can use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator. pUC119 PDS3 AT4G14210, DL3145C, FCAALL.28, PDE226, PDS, PHYTOENE DESATURASE, PIGMENT DEFECTIVE 226, phytoene desaturase 3 Add to Cart
    pSAG1::CAS9-U6::sgUPRTSAG1 5' UTR (Other)CRISPR ; Toxoplasma expression Sibley Efficient Gene Disruption in Diverse Strains of Toxoplasma gondii Using CRISPR/CAS9. MBio. 2014 May 13;5(3). pii: e01114-14. doi: 10.1128/mBio.01114-14. Encodes CAS9 nuclease (GFP fusion) under control of the Toxoplasma gondii SAG1 promotor. Vector also provides U6 controlled expression of a single guide RNA for disruption of genes by CRISPR. pBlueScript Add to Cart
    CMVp-dsRed2-Triplex-28-gRNA1-28-pAdsRed2 (Homo sapiens)Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. Plasmid encoding the Triplex/gRNA architecture.This is a modified form of the original plasmid described in the paper (Construct 3). mKate2 was replaced with dsRed2 because of distribution issues. pGL2-Luc (Addgene #26280) Add to Cart
    CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pAdsRed2 (Homo sapiens)Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. Plasmid encoding the Ribozyme/gRNA architecture. This is a modified form of the original plasmid described in the paper (Construct 13). mKate2 was replaced with dsRed2 because of distribution issues. pGL2-Luc (Addgene #26280) Add to Cart
    CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pAdsRed2 (Homo sapiens)Mammalian Expression, Synthetic Biology Lu Multiplexed and Programmable Regulation of Gene Networks with an Integrated RNA and CRISPR/Cas Toolkit in Human Cells. Mol Cell. 2014 May 14. pii: S1097-2765(14)00355-4. doi: 10.1016/j.molcel.2014.04.022. Plasmid encoding multiplexed 4x gRNAs. This is a modified form of the original plasmid described in the paper (Construct 19). mKate2 was replaced with dsRed2 because of distribution issues. pGL2-Luc (Addgene #26280) Add to Cart
    pCCM935unc-22 sgRNA (Caenorhabditis elegans)Worm Expression Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans. Genetics. 2014 May 30. pii: genetics.114.166389. Expresses unc-22 sgRNA in C.elegans. Can be used in Co-CRISPR experiments. pCR-Blunt II-TOPO Add to Cart
    pAdSh.U6.gRNAS1U6.gRNAS1 cassette (Synthetic)Mammalian Expression, Adenoviral, CRISPR Goncalves Adenoviral vector delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi: 10.1038/srep05105. U6 promoter-driven single guide RNA complementary to the human AAVS1 locus pBR322-derived pAdEasy plasmid Add to Cart
    pAdSh.U6.gRNAGFPU6.gRNAGFP cassette (Synthetic)Mammalian Expression, Adenoviral, CRISPR Goncalves Adenoviral vector delivery of RNA-guided CRISPR/Cas9 nuclease complexes induces targeted mutagenesis in a diverse array of human cells. Sci Rep. 2014 May 29;4:5105. doi: 10.1038/srep05105. U6 promoter-driven single guide RNA complementary to eGFP pBR322-derived pAdEasy plasmid Add to Cart
    pX330A-1x2humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pX330A-1x3humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pX330A-1x4humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pX330A-1x5humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pX330A-1x6humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pX330A-1x7humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pX330S-2humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pX330S-3humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pX330S-4humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pX330S-5humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pX330S-6humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pX330S-7humanized S. pyogenes Cas9 nuclease (Other)Mammalian Expression, CRISPR Yamamoto Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014 Jun 23;4:5400. doi: 10.1038/srep05400. Expresses Cas9 nuclease and gRNA pUC ori vector Add to Cart
    pCCM936avr-14 sgRNA (Caenorhabditis elegans)Worm Expression, CRISPR Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans. Genetics. 2014 May 30. pii: genetics.114.166389. Expresses avr-14 sgRNA in C.elegans. pCR-Blunt II-TOPO Add to Cart
    pCCM937avr-15 sgRNA (Caenorhabditis elegans)Worm Expression, CRISPR Mello A Co-CRISPR Strategy for Efficient Genome Editing in Caenorhabditis elegans. Genetics. 2014 May 30. pii: genetics.114.166389. Expresses avr-15 sgRNA in C.elegans. pCR-Blunt II-TOPO Add to Cart
    Human BLIMP1 sgRNAhBLIMP1 sgRNA (Homo sapiens)Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 Plasmid encoding sgRNA to generate BLIMP1 knockout mutant human cells px330 Add to Cart
    Human SOX17 sgRNAhSox17 sgRNA (Homo sapiens)Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 Plasmid encoding sgRNA to generate SOX17 knock-out mutant human cells px330 Add to Cart
    Human T (BRACHYURY) sgRNAhT sgRNA (Homo sapiens)Mammalian Expression, CRISPR Hanna SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate Cell 160, 1–16, January 15, 2015 Plasmid encoding sgRNA to generate T (BRACHYURY) knock-out mutant human cells px330 Add to Cart
    pSAG1::CAS9-U6::sg290860-6CRISPR sg290860-6CRISPR ; ; Toxoplasma gondii Sibley Genetic mapping reveals that sinefungin resistance in Toxoplasma gondii is controlled by a putative amino acid transporter locus that can be used as a negative selectable marker. Eukaryot Cell. 2014 Dec 5. pii: EC.00229-14. Encodes CAS9 nuclease (GFP fusion) under control of the Toxoplasma gondii SAG1 promotor. Vector also provides U6 controlled expression of a single guide RNA for CRISPR disruption of TGME49_290860. pBlueScript Add to Cart
    pMZ288Cas9 (Other), rrk1:sgRNA (Other)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Combination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: sgRNA targeted against ade6+ pMZ283 Add to Cart
    pMZ289Cas9 (Other), rrk1:sgRNA (Other)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Combination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: sgRNA targeted against ade6-M210 pMZ283 Add to Cart
    pMZ381Cas9 (Other), rrk1:sgRNA (Other)Yeast Expression, CRISPR Zaratiegui Implementation of the CRISPR-Cas9 system in fission yeast. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. Combination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: sgRNA targeted against ade6-L469 pMZ283 Add to Cart
    pX330 PtensgRNA targeting Pten (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589. pX330 backbone expressing sgRNA targeting Pten to edit mouse Pten. Expresses Cas9 from CBh promoter pX330 Pten 2310035O07Rik, A130070J02Rik, AI463227, B430203M17Rik, MMAC1, PTENbeta, TEP1 Add to Cart
    pX330 p53sgRNA targeting p53 (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589. pX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoter pX330 Trp53 Tp53, bbl, bfy, bhy, p44, p53 Add to Cart
    pX330 Ctnnb1.1sgRNA targeting Ctnnb1 (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589. pX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoter pX330 Ctnnb1 Bfc, Catnb, Mesc Add to Cart
    pX330 Ctnnb1.2Ctnnb1 (Mus musculus)Mammalian Expression, CRISPR Jacks CRISPR-mediated direct mutation of cancer genes in the mouse liver. Nature. 2014 Aug 6. doi: 10.1038/nature13589. pX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoter pX330 Ctnnb1 Bfc, Catnb, Mesc Add to Cart
    pJA45rde-1(D718) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730. gRNA for cleavage at rde-1(D718) locus in C elegans pRB1017 Add to Cart
    pJA46rde-1(D801) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730. gRNA for cleavage at rde-1(D801) locus in C elegans pRB1017 Add to Cart
    pJA14rde-1(H974) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730. gRNA for cleavage at rde-1(H974) locus in C elegans pRB1017 Add to Cart
    pJA42rol-6(su1006) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730. gRNA for cleavage at rol-6(su1006) locus in C elegans pRB1017 Add to Cart
    pJA50unc-58(e665) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730. gRNA for cleavage at unc-58(e665) locus in C elegans pRB1017 Add to Cart
    pJA59unc-109(n499) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730. gRNA for cleavage at unc-109(n499) locus in C elegans pRB1017 Add to Cart
    pJA58dpy-10(cn64) gRNA (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730. gRNA for cleavage at dpy-10(cn64) locus in C elegans pRB1017 Add to Cart
    pJA55sqt-1(e1350) gRNA2 (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730. gRNA for cleavage near sqt-1(e1350) locus in C elegans pRB1017 Add to Cart
    U6>Ebf.774(F+E)Ebf.774 (F+E) sgRNACRISPR Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. U6 promoter driving Ebf.774 (F+E) sgRNA pCESAx Add to Cart
    U6>Control(F+E)Control (F+E) sgRNACRISPR Christiaen Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. U6 promoter driving control (F+E) sgRNA pCESAx Add to Cart
    RFN_EGFP_47pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Expresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nuclease pSQT1313 Add to Cart
    RFN_EGFP_80pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Expresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nuclease pSQT1313 Add to Cart
    RFN_EGFP_81pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Expresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nuclease pSQT1313 Add to Cart
    RFN_EGFP_82pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Expresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nuclease pSQT1313 Add to Cart
    RFN_EGFP_83pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Expresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nuclease pSQT1313 Add to Cart
    RFN_EGFP_84pair of multiplex gRNAs targeting EGFPMammalian Expression, CRISPR Joung Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat Biotechnol. 2014 Apr 25. doi: 10.1038/nbt.2908. Expresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nuclease pSQT1313 Add to Cart
    pJA54sqt-1(e1350) gRNA1 (Caenorhabditis elegans)CRISPR Fire Efficient Marker-Free Recovery of Custom Genetic Modifications with CRISPR/Cas9 in Caenorhabditis elegans. Genetics. 2014 Aug 26. pii: genetics.114.169730. cleavage near e1350 locus in sqt-1 pRB1017 Add to Cart
    AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR (AAV-KPL)sgRNA (Synthetic), Renilla luciferase, Cre recombinase, KrasG12D HDR donor (Mus musculus)Mammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Expresses Cre recombinase and Renilla luciferase from the EFS promoter and three U6-driven sgRNAs targeting Kras, p53, and Lkb1. Contains KrasG12D HDR donor. AAV backbone. AAV Kras AI929937, K-Ras, K-Ras 2, K-ras, Ki-ras, Kras-2, Kras2, c-K-ras, c-Ki-ras, p21B, ras Add to Cart
    AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITRsgRNA, Renilla luciferase, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR, Luciferase Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Expresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA targeting LacZ. AAV backbone. AAV Add to Cart
    AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITRsgRNA, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Expresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA targeting the mouse gene NeuN. AAV backbone. AAV Add to Cart
    AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITRsgRNA, Cre recombinaseMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Expresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA control targeting LacZ. AAV backbone. AAV Add to Cart
    AAV:ITR-U6-sgRNA(NeuN)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITRsgRNA, Cre recombinase, EGFPMammalian Expression, Mouse Targeting, AAV, Cre/Lox, CRISPR Zhang CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. Expresses Cre recombinase and KASH-tagged EGFP from the hSyn promoter and one U6-driven sgRNA. AAV backbone with SapI spacer for sgRNA cloning. AAV Add to Cart
    gRNA-eGFP-ReportergRNA (5'-AAAGGTCGAGAAACTGCAAA-3')Mammalian Expression, CRISPR Gersbach A light-inducible CRISPR-Cas9 system for control of endogenous gene activation. Nat Chem Biol. 2015 Feb 9. doi: 10.1038/nchembio.1753. Expresses guide RNA used to activate pGL3-Basic-8x-gRNA-eGFP reporter. pzDonor Add to Cart
    pCASS. pyogenese Cas9 (Other), RNA pol III promoter (tRNA-Tyr) (Saccharomyces cerevisiae), hepatitis delta virus ribozyme, genomic (Other), sgRNA (Synthetic)Bacterial Expression, Yeast Expression, CRISPR, Synthetic Biology Cate Selection of chromosomal DNA libraries using a multiplex CRISPR system. Elife. 2014 Aug 19;3. doi: 10.7554/eLife.03703. Expresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeast 2-micron/pUC Add to Cart
    pLV-sgCDKN1B#2 BFPBFPMammalian Expression, Lentiviral, CRISPR Vale A Protein-Tagging System for Signal Amplification in Gene Expression and Fluorescence Imaging. Cell. 2014 Oct 8. pii: S0092-8674(14)01227-6. doi: 10.1016/j.cell.2014.09.039. A lentiviral plasmid that encodes both a sgRNA targeting CDKN1B and BFP pHR Add to Cart
    pT7-gRNA:Tyr (albino)Tyrosinase gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Expression vector of rat Tyr (albino) guide RNA DR274 Add to Cart
    pT7-gRNA:Tyr (wild)Tyrosinase gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Expression vector of rat Tyr (wild) guide RNA DR274 Add to Cart
    pT7-gRNA:AsipAgouti signaling protein gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Expression vector of rat Asip guide RNA DR274 Add to Cart
    pT7-gRNA:kit-1v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Expression vector of rat Kit-1 guide RNA DR274 Add to Cart
    pT7-gRNA:kit-2-1v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Expression vector of rat Kit-2-1 guide RNA DR274 Add to Cart
    pT7-gRNA:kit-2-2v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Rattus norvegicus)CRISPR Mashimo Allele-specific genome editing and correction of disease-associated phenotypes in rats using the CRISPR-Cas platform. Nat Commun. 2014 Jun 26;5:4240. doi: 10.1038/ncomms5240. Expression vector of rat Kit-2-2 guide RNA DR274 Add to Cart
    DR274-eGFP sgRNAEGFP sgRNA (Synthetic)CRISPR Del Bene Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Genome Res. 2014 Jan;24(1):142-53. doi: 10.1101/gr.161638.113. Epub 2013 Oct 31. for generation of a eGFP specific sgRNA from a T7 promoter DR274 Add to Cart
    gRNA-hIRF-1 #12gRNA_hIRF1 promoter #12 (Homo sapiens)Mammalian Expression, CRISPR Fujii Efficient isolation of specific genomic regions and identification of associated proteins by engineered DNA-binding molecule-mediated chromatin immunoprecipitation (enChIP) using CRISPR. Biochem Biophys Res Commun. 2013 Aug 11. pii: S0006-291X(13)01329-6. doi: 10.1016/j.bbrc.2013.08.013. Expresses a guide RNA (gRNA) to target human IRF-1 promoter pCR-Blunt II-TOPO IRF1 IRF-1, MAR Add to Cart
    gRNA-hIRF-1 #12/pSIRgRNA_hIRF1 promoter #12 (Homo sapiens)Mammalian Expression, Retroviral, CRISPR Fujii Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. Expresses a guide RNA (gRNA) to target human IRF-1 promoter pSIR IRF1 IRF-1, MAR Add to Cart
    pJW1219sgRNA(F+E) (Synthetic)Worm Expression, CRISPR Ward Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Genetics. 2014 Dec 9. pii: genetics.114.172361. CRISPR/Cas9 plasmid containing sgRNA(F+E); for use in C. elegans pDD162 Add to Cart
    pJW1285sgRNA(F+E) targeting pha-1 (Synthetic)Worm Expression, CRISPR Ward Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Genetics. 2014 Dec 9. pii: genetics.114.172361. CRISPR/Cas9 plasmid with sgRNA(F+E) targeting pha-1; for co-conversion in C. elegans pJW1219 Add to Cart
    pMM178Cas9, tracrRNA, crRNA (Other)Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011. Also referred to as pRGNndm-1. Expresses Cas9, tracrRNA and a guide RNA which target the NDM-1 gene. Contains a pBBR1 origin and chloramphenicol resistance. Custom pBBR1-CmR Add to Cart
    pMM441Cas9, tracrRNA, crRNA (Other)Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011. Also referred to as mRGNndm-1. Expresses Cas9, tracrRNA and a guide RNA which target the NDM-1 gene. Contains an R1162 origin and chloramphenicol resistance. Can be mobilized by S17-1 lambda pir. Custom pR1162-CmR Add to Cart
    pRC319Cas9, tracrRNA, crRNA (Other)Bacterial Expression, CRISPR Lu Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011. Also referred to as pΦRGNndm-1. Expresses Cas9, tracrRNA and a guide RNA targeting the NDM-1 gene. Contains a ColE1 origin, kanamycin resistance cassette and f1 origin for packaging in M13 particles. pZE22G Add to Cart
    px335 Mettl14 sgRNA #2gccgctcccggatctcctgc (Mus musculus)Mammalian Expression, CRISPR Hanna m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 1 January 2015 encodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy) px335 Add to Cart
    px335 Mettl14 sgRNA #1gcggcagctcctagctcagc (Mus musculus)Mammalian Expression, CRISPR Hanna m6A mRNA methylation facilitates resolution of naïve pluripotency toward differentiation. Science 1 January 2015 encodes sgRNA sequence for targeting mouse Mettl14 locus (Cas9-Nickase strategy) px335 Add to Cart
    px330-USP13USP13 (Homo sapiens)CRISPR Ye USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. to make USP13 Knockout cell line pX330-U6-Chimeric_BB-CBh-hSpCas9 USP13 ISOT3, IsoT-3 Add to Cart
    px330-gp78gp78 (Homo sapiens)CRISPR Ye USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. to make gp78 Knockout cell line pX330-U6-Chimeric_BB-CBh-hSpCas9 AMFR GP78, RNF45 Add to Cart
    MLM3636-Prnp-CDS-NegPrP guiding sequence (Mus musculus)Mammalian Expression, CRISPR Schmitt-Ulms CRISPR-Cas9-Based Knockout of the Prion Protein and Its Effect on the Proteome. PLoS One. 2014 Dec 9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014. Expresses a gRNA plasmid targeting the prion gene's exon 3, negative strand MLM3636 Prnp AA960666, AI325101, CD230, PrP, PrP<C>, PrPC, PrPSc, Prn-i, Prn-p, Sinc, prP27-30, prP33-35C Add to Cart
    MLM3636-Prnp-CDS-PosPrP guiding sequence (Mus musculus)Mammalian Expression, CRISPR Schmitt-Ulms CRISPR-Cas9-Based Knockout of the Prion Protein and Its Effect on the Proteome. PLoS One. 2014 Dec 9;9(12):e114594. doi: 10.1371/journal.pone.0114594. eCollection 2014. Expresses a gRNA plasmid targeting the prion gene's exon 3, positive strand MLM3636 Prnp AA960666, AI325101, CD230, PrP, PrP<C>, PrPC, PrPSc, Prn-i, Prn-p, Sinc, prP27-30, prP33-35C Add to Cart
    pTargetFsgRNA (Synthetic)Bacterial Expression, CRISPR Yang Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14. Constitutive expression of sgRNA without donor editing template DNA Trc99a Add to Cart
    pAN-PBAD-sgRNA-A1NTA1NT (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of A1NT sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-PBAD-sgRNA-A1TA1T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of A1T sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-PBAD-sgRNA-A2NTA2NT sgRNABacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of A2NT sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-PBAD-sgRNA-A2TA2T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of A2T sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-PBAD-sgRNA-A3NTA3NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of A3NT sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-PBAD-sgRNA-A3TA3T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of A3T sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-PBAD-sgRNA-A4NTA4NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of A4NT sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-PBAD-sgRNA-A4TA4T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of A4T sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-PBAD-sgRNA-A5NTA5NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of A5NT sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-PBAD-sgRNA-A5TA5T sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of A5T sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-PBAD-sgRNA-scramblescramble sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of scramble sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-PBAD-sgRNA-VRVR sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. expression of VR sgRNA from the arabinose-inducible promoter unknown Add to Cart
    pAN-NORA2NT sgRNA (Synthetic), A2NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. synthetic circuit: NOR gate unknown Add to Cart
    pAN-ANDA1NT sgRNA (Synthetic), A4NT sgRNA (Synthetic), A2NT sgRNA (Synthetic), A1NT (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. synthetic circuit: AND gate unknown Add to Cart
    pAN-OR-MalT-3NTA2NT sgRNA (Synthetic), Malt-3NT sgRNA (Synthetic), A2NT sgRNA (Synthetic)Bacterial Expression, CRISPR Voigt Multi-input CRISPR/Cas genetic circuits that interface host regulatory networks. Mol Syst Biol. 2014 Nov 24;10:763. doi: 10.15252/msb.20145735. synthetic circuit: OR gate, the sgRNA used for the NOT gate was substituted with one designed to target the malT gene in the E. coli genome unknown Add to Cart
    pJZC545sgRNA + 1x MS2 binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA with 1x MS2 for yeast cells pRS416 Add to Cart
    pJZC583sgRNA + 2x MS2 binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA with 2x MS2 for yeast cells pRS416 Add to Cart
    pJZC588sgRNA + 2x MS2 (wt+f6) binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA with 2x MS2 (wt+f6) for yeast cells pRS416 Add to Cart
    pJZC548sgRNA + 1x PP7Yeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA with 1x PP7 for yeast cells pRS416 Add to Cart
    pJZC603sgRNA + 2x PP7 RNA binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA with 2x PP7 for yeast cells pRS416 Add to Cart
    pJZC572sgRNA + 1x com RNA binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA with 1x com for yeast cells pRS416 Add to Cart
    pJZC593sgRNA + MS2-PP7 RNA binding moduleYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA with MS2-PP7 for yeast cells pRS416 Add to Cart
    pJZC523sgRNAYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA for yeast cells pRS416 Add to Cart
    pJZC625sgRNA +1x MS2, Pol II promoter with ribozyme cleavageYeast Expression Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA with 1x MS2, Pol II promoter with ribozyme-gRNA-ribozyme design for yeast cells pSV616 Add to Cart
    pJZC35sgRNAMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA for mammalian cells with mCherry marker MP177_U6 (derived from pSico) Add to Cart
    pJZC32sgRNA, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC25sgRNA + 1x MS2 binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1x MS2 with MCP-VP64 effector for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC33sgRNA + 2x MS2 binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 2x MS2 with MCP-VP64 effector for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC34sgRNA + 2x MS2(wt+f6) binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC41sgRNA, PCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA (no RNA aptamer addition) with PCP-VP64 effector for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC39sgRNA + 1x PP7, mCherryMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1x PP7 with mCherry for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC40sgRNA + 2x PP7, mCherryMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 2x PP7 with mCherry for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC101sgRNA, COM-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA (no RNA aptamer addition) with COM-VP64 effector for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC48sgRNA + 1x COM binding module, COM-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1x COM with COM-VP64 effector for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC102sgRNAMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA for mammalian cells with mCherry marker MP177_U6 (derived from pSico) Add to Cart
    pJZC77sgRNA, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC78sgRNA + 1x COM binding module, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1x COM with COM-KRAB effector for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC103sgRNAMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA for mammalian cells with mCherry marker MP177_U6 (derived from pSico) Add to Cart
    pJZC73sgRNA, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC74sgRNA + 1x COM binding module, COM-KRABMammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1x COM with COM-KRAB effector for mammalian cells MP177_U6 (derived from pSico) Add to Cart
    pJZC116sgRNA + 2x MS2 (wt+f6) binding module, MCP-VP64Mammalian Expression, Lentiviral Qi Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFP MP177_U6 (derived from pSico) Add to Cart
    pKCcas9dOScocas9 (Other), sgRNA (), act-orf4 homology armBacterial Expression, CRISPR ; Bacterial Genome Editing Jiang One-step high-efficiency CRISPR/Cas9-mediated genome editing in Streptomyces. Acta Biochim Biophys Sin (Shanghai). 2015 Apr;47(4):231-43. doi: 10.1093/abbs/gmv007. Epub 2015 Mar 3. High efficiency Streptomyces genome editing by CRISPR/Cas9 system pKC1139 Add to Cart
    ptreCas9-mKate2ps-T1gRNACas9–mKate2ps (Synthetic)Mammalian Expression Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. Inducible; gRNA seq is ATGAGAATCAAGGCGGTCGA pTag-CFP Add to Cart
    pCas9–mKate2ps–T1gRNACas9–mKate2ps (Synthetic)Mammalian Expression Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. t1 gRNA (ATGAGAATCAAGGCGGTCGA) pTag-CFP Add to Cart
    PX458_CEBPB_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human CEBPB along with Cas9 with 2A GFP px548 Add to Cart
    PX458_CEBPB_2gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human CEBPB along with Cas9 with 2A GFP px548 Add to Cart
    PX458_RAD21_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human RAD21 along with Cas9 with 2A GFP px548 Add to Cart
    Adeno EAU6_sgRNA(Alk)_U6_sgRNA(Eml4)_CBh_FLAG-Cas9 (Mus musculus)Adenoviral Ventura In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014 Dec 18;516(7531):423-7. doi: 10.1038/nature13902. Epub 2014 Oct 22. Adenovirus for the expression of gRNAs targeting intron 19 of murine Alk and intron 14 of Eml4 pacAd5 Add to Cart
    sgRNA1_ASCL1sgRNA1_ASCL1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette. pgRNA-humanized ASCL1 ASH1, HASH1, MASH1, bHLHa46 Add to Cart
    sgRNA2_ASCL1sgRNA1_ASCL2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassette. pgRNA-humanized ASCL1 ASH1, HASH1, MASH1, bHLHa46 Add to Cart
    sgRNA3_ASCL1sgRNA1_ASCL3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassette. pgRNA-humanized ASCL1 ASH1, HASH1, MASH1, bHLHa46 Add to Cart
    sgRNA4_ASCL1sgRNA1_ASCL4 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassette. pgRNA-humanized ASCL1 ASH1, HASH1, MASH1, bHLHa46 Add to Cart
    sgRNA1_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of MYOD1 sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette. pgRNA-humanized MYOD1 MYF3, MYOD, PUM, bHLHc1 Add to Cart
    sgRNA2_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of MYOD1 sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassette. pgRNA-humanized MYOD1 MYF3, MYOD, PUM, bHLHc1 Add to Cart
    sgRNA3_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of MYOD1 sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized MYOD1 MYF3, MYOD, PUM, bHLHc1 Add to Cart
    sgRNA4_MYOD1sgRNA1_MYOD1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of MYOD1 sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized MYOD1 MYF3, MYOD, PUM, bHLHc1 Add to Cart
    sgRNA1_IL1RNIL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of IL1RN sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized IL1RN DIRA, ICIL-1RA, IL-1RN, IL-1ra, IL-1ra3, IL1F3, IL1RA, IRAP, MVCD4 Add to Cart
    sgRNA2_IL1RNsgRNA2_IL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of IL1RN sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized IL1RN DIRA, ICIL-1RA, IL-1RN, IL-1ra, IL-1ra3, IL1F3, IL1RA, IRAP, MVCD4 Add to Cart
    sgRNA3_IL1RNsgRNA3_IL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of IL1RN sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized IL1RN DIRA, ICIL-1RA, IL-1RN, IL-1ra, IL-1ra3, IL1F3, IL1RA, IRAP, MVCD4 Add to Cart
    sgRNA4_IL1RNsgRNA4_IL1RN (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of IL1RN sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized IL1RN DIRA, ICIL-1RA, IL-1RN, IL-1ra, IL-1ra3, IL1F3, IL1RA, IRAP, MVCD4 Add to Cart
    sgRNA1_NANOGsgRNA1_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of NANOG sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized NANOG Add to Cart
    sgRNA2_NANOGsgRNA2_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of NANOG sgRNA2. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized NANOG Add to Cart
    sgRNA3_NANOGsgRNA3_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of NANOG sgRNA3. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized NANOG Add to Cart
    sgRNA4_NANOGsgRNA4_NANOG (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of NANOG sgRNA4. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized NANOG Add to Cart
    sgRNA1_GAL4UAS-Luciferase reportersgRNA1 for GAL4UAS-Luciferase reporter (Synthetic)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of sgRNA1 to target GAL4UAS-luciferase. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized Add to Cart
    sgRNA2_GAL4UAS-Luciferase reportersgRNA2 for GAL4UAS-Luciferase reporter (Synthetic)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of sgRNA2 to target GAL4UAS-luciferase. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized Add to Cart
    sgRNA3_GAL4UAS-Luciferase reportersgRNA3 for GAL4UAS-Luciferase reporter (Synthetic)Mammalian Expression, Lentiviral, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Lentiviral expression of sgRNA3 to target GAL4UAS-luciferase. Also contains a CMV-puro-t2A-mCherry expression cassette pgRNA-humanized Add to Cart
    sgRNA1_pNeurog2-Luciferase reportersgRNA1 for pNeurog2-Luciferase reporter (Synthetic)Mammalian Expression, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Mammalian expression of sgRNA1 to target pNeurog2-Luciferase reporter. pSPgRNA Add to Cart
    sgRNA1_Tet-inducible Luciferase reportersgRNA1 for Tet-inducible Luciferase reporter (Synthetic)Mammalian Expression, CRISPR Sato CRISPR-Cas9-based Photoactivatable Transcription System. Chem Biol. 2015 Feb 19;22(2):169-74. doi: 10.1016/j.chembiol.2014.12.011. Epub 2015 Jan 22. Photoactivatable transcription system. Mammalian expression of sgRNA1 to target Tet-inducible-luciferase reporter. pSPgRNA Add to Cart
    pU6-sgRosa26-1_CBh-Cas9-T2A-BFPCas9 (Other), sgRNA targeting ROSA26-1Mammalian Expression, CRISPR Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked to BFP via a T2A peptide pU6-(BbsI)_CBh-Cas9-T2A-BFP Add to Cart
    pU6-sgRosa26-1_CBh-Cas9-T2A-BFP-P2A-Ad4E1BCas9 (Other), sgRNA targeting ROSA26-1Mammalian Expression, CRISPR Kuehn Increasing the efficiency of homology-directed repair for CRISPR-Cas9-induced precise gene editing in mammalian cells. Nat Biotechnol. 2015 Mar 24. doi: 10.1038/nbt.3198. Expression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked via T2A to BFP linked to the Ad4 E1B55K gene via P2A pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B Add to Cart
    pU6a:sgRNA(tyr)U6a:sgRNA (tyr) (Danio rerio)CRISPR Chen Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 2015 Apr 8. pii: genetics.115.176917. expresses sgRNA(tyr) under U6a promoter pLR-NN Add to Cart
    PX458_GABPA_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human GABPA along with Cas9 with 2A GFP px548 Add to Cart
    PX458_GABPA_2gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human GABPA along with Cas9 with 2A GFP px548 Add to Cart
    gRNA-ura-HYBgBlock product of ura3 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3. ura3 deletion gRNA cassette carried by pRS42H pRS42H Add to Cart
    gRNA-trp-HYBgBlock product of trp1 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3. trp1 deletion gRNA cassette carried by pRS42H pRS42H Add to Cart
    gRNA-leu-HYBgBlock product of leu2 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3. leu2 deletion gRNA cassette carried by pRS42H pRS42H Add to Cart
    gRNA-his-HYBgBlock product of his3 deletion gRNA cassette (Synthetic)Yeast Expression Jin Construction of a quadruple auxotrophic mutant of an industrial polyploid saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease. Appl Environ Microbiol. 2014 Dec;80(24):7694-701. doi: 10.1128/AEM.02310-14. Epub 2014 Oct 3. his3 deletion gRNA cassette carried by pRS42H pRS42H Add to Cart
    pRPR1_a1gRNA_RPR1ta1 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes a1 gRNA pRS425 Add to Cart
    pRPR1_c1gRNA_RPR1tc1 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes c1 gRNA pRS425 Add to Cart
    pRPR1_c2gRNA_RPR1tc2 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes c2 gRNA pRS425 Add to Cart
    pRPR1_c3gRNA_RPR1tc3 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes c3 gRNA pRS425 Add to Cart
    pRPR1_c4gRNA_RPR1tc4 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes c4 gRNA pRS425 Add to Cart
    pRPR1_c5gRNA_RPR1tc5 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes c5 gRNA pRS425 Add to Cart
    pRPR1_c6gRNA_RPR1tc6 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes c6 gRNA pRS425 Add to Cart
    pRPR1_c7gRNA_RPR1tc7 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes c7 gRNA pRS425 Add to Cart
    pRPR1_c8gRNA_RPR1tc8 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes c8 gRNA pRS425 Add to Cart
    pRPR1_g1gRNA_RPR1tg1 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes g1 gRNA pRS425 Add to Cart
    pRPR1_g2gRNA_RPR1tg2 gRNA (Saccharomyces cerevisiae)Yeast Expression Lu Tunable and Multifunctional Eukaryotic Transcription Factors Based on CRISPR/Cas. ACS Synth Biol. 2013 Sep 11. encodes g2 gRNA pRS425 Add to Cart
    PX458_ATF1_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human ATF1 along with Cas9 with 2A GFP px548 Add to Cart
    PX458_CREB1_1gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human CREB1 along with Cas9 with 2A GFP px548 Add to Cart
    PX458_CREB1_2gRNACRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Expresses gRNA against human CREB1 along with Cas9 with 2A GFP px548 Add to Cart
    pCas9–mKate2ps–CgRNACas9–mKate2psMammalian Expression Bleris CRISPR-based self-cleaving mechanism for controllable gene delivery in human cells. Nucleic Acids Res. 2015 Jan 30;43(2):1297-303. doi: 10.1093/nar/gku1326. Epub 2014 Dec 18. Control gRNA (GTCAAGGCACTCTTGCCTA) pTag-CFP Add to Cart
    pT7-th-sgRNAth sgRNA (Danio rerio)in vitro RNA transcription Du Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system. Cell Res. 2015 Apr 7. doi: 10.1038/cr.2015.43. in vitro trancription of sgRNA targeting the zebrafish th locus PT7-sgRNA th Add to Cart
    pT7-gfap-sgRNAgfap sgRNA (Danio rerio)in vitro RNA transcription Du Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system. Cell Res. 2015 Apr 7. doi: 10.1038/cr.2015.43. in vitro trancription of sgRNA targeting the zebrafish gfap locus PT7-sgRNA gfap cb345, etID36982.3, gfapl, wu:fb34h11, wu:fk42c12, xx:af506734, zgc:110485 Add to Cart
    AP56-5sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162 Add to Cart
    AP56-6sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162 Add to Cart
    AP56-7sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162 Add to Cart
    AP56-8sgRNA for APa13 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162 Add to Cart
    AP54-3sgRNA for APs12 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162 Add to Cart
    AP54-5sgRNA for APs12 (Caenorhabditis elegans)Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans fbf-2 gene pDD162 Add to Cart
    pIK208U6 promoter::dpy-10 sgRNA with a "flipped and extended" sgRNA backbone (Caenorhabditis elegans)Worm Expression, CRISPR Katic CRISPR/Cas9 Genome Editing in Caenorhabditis elegans: Evaluation of Templates for Homology-Mediated Repair and Knock-Ins by Homology-Independent DNA Repair. G3 (Bethesda). 2015 Jun 3. pii: g3.115.019273. doi: 10.1534/g3.115.019273. sgRNA targeting dpy-10 (Arribere et al., 2014) expressed from a C. elegans U6 promoter (Friedland et al., 2013), in a "flipped and extended" sgRNA backbone (Chen et al., 2013)" pUC57 Add to Cart
    APq5271sgRNA for APa4-2Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORF pDD162 Add to Cart
    APq5210sgRNA for APa4-2Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting K08F4.2 in the middle of the ORF pDD162 Add to Cart
    AP303-3sgRNA for APs1Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2 pDD162 Add to Cart
    AP303-4sgRNA for APs1Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2 pDD162 Add to Cart
    AP332-2sgRNA for APs4Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2 pDD162 Add to Cart
    AP332-3sgRNA for APs4Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2 pDD162 Add to Cart
    AP332-4sgRNA for APs4Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 5'end of C.elegans K08F4.2 pDD162 Add to Cart
    AP324-2sgRNA for APs6Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162 Add to Cart
    AP324-3sgRNA for APs6Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162 Add to Cart
    AP324-4sgRNA for APs6Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162 Add to Cart
    AP334-2sgRNA for APs5Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162 Add to Cart
    AP334-5sgRNA for APs5Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162 Add to Cart
    AP334-6sgRNA for APs5Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans K08F4.2 pDD162 Add to Cart
    APCSD 53sgRNA for CSD 53Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans swan-2 pDD162 Add to Cart
    APCSD 54sgRNA for CSD 54Worm Expression, CRISPR Seydoux Scalable and versatile genome editing using linear DNAs with microhomology to Cas9 Sites in Caenorhabditis elegans. Genetics. 2014 Dec;198(4):1347-56. doi: 10.1534/genetics.114.170423. Epub 2014 Sep 23. co-expression of Cas9 and a sgRNA targeting 3'end of C.elegans swan-2 pDD162 Add to Cart
    pJZC42sgRNA + 1XPP7, PCP-VP64 IRES mCherryMammalian Expression Lim Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 1XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherry pSico Add to Cart
    pJZC43sgRNA + 2XPP7, PCP-VP64 IRES mCherryMammalian Expression Lim Engineering Complex Synthetic Transcriptional Programs with CRISPR RNA Scaffolds. Cell. 2014 Dec 18. pii: S0092-8674(14)01570-0. doi: 10.1016/j.cell.2014.11.052. sgRNA + 2XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherry pSico Add to Cart
    pX330.iGFP1iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for iGFP pX330 Add to Cart
    pX330.iGFP2iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for iGFP pX330 Add to Cart
    pX330.iGFP3iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for iGFP pX330 Add to Cart
    pX330.iGFP5iGFPMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for iGFP pX330 Add to Cart
    pX330.LoxPOLSL-TomatoMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for LSL pX330 Add to Cart
    pX330.LoxPLoxP sgRNAMammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for LSL pX330 Add to Cart
    pX330.Pten.aPten deletion (Mus musculus)Mammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for Pten deletion pX330 Pten 2310035O07Rik, A130070J02Rik, AI463227, B430203M17Rik, MMAC1, PTENbeta, TEP1 Add to Cart
    pX330.Pten.bPten deletion (Mus musculus)Mammalian Expression Xue A versatile reporter system for CRISPR-mediated chromosomal rearrangements. Genome Biol. 2015 May 28;16(1):111. sgRNA for Pten deletion pX330 Pten 2310035O07Rik, A130070J02Rik, AI463227, B430203M17Rik, MMAC1, PTENbeta, TEP1 Add to Cart
    Lenti-sgLkb1/CresgLkb1 (Mus musculus)Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR Winslow Pancreatic cancer modeling using retrograde viral vector delivery and in vivo CRISPR/Cas9-mediated somatic genome editing. Genes Dev. 2015 Jul 15;29(14):1576-85. doi: 10.1101/gad.264861.115. Epub 2015 Jul 15. Expresses an Lkb1-targeting gRNA and Cre-recombinase pLL3.3 Add to Cart
    Lenti-sgNT/CresgNT (Mus musculus)Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR Winslow Pancreatic cancer modeling using retrograde viral vector delivery and in vivo CRISPR/Cas9-mediated somatic genome editing. Genes Dev. 2015 Jul 15;29(14):1576-85. doi: 10.1101/gad.264861.115. Epub 2015 Jul 15. Expresses a non-targeting gRNA and Cre-recombinase pLL3.3 Add to Cart
    pCAS9-mCherry-TUBBgRNA TUBB Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint target selector TUBB pCAS9-mCherry Add to Cart
    pCAS9-mCherry-ACTG1gRNA ACTG1 (Homo sapiens) Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint target selector ACTG1 pCAS9-mCherry Add to Cart
    pCAS9-mCherry-HIST1H4CgRNA HIST1H4C (Homo sapiens) Hornung CRISPaint allows modular base-specific gene tagging using a ligase-4-dependent mechanism. Nat Commun. 2016 Jul 28;7:12338. doi: 10.1038/ncomms12338. CRISPaint target selector HIST1H4C pCAS9-mCherry Add to Cart
    Oct4-Cr1gRNA for Crispr targeting the OCT4 stop codon (Homo sapiens)Mammalian Expression Huangfu A CRISPR/Cas-Mediated Selection-free Knockin Strategy in Human Embryonic Stem Cells. Stem Cell Reports. 2015 May 28. pii: S2213-6711(15)00128-9. doi: 10.1016/j.stemcr.2015.04.016. Expresses gRNA that targets stop codon for OCT4 piCRg Entry (Addgene plasmid #58904) Add to Cart
    Lenti-sgNeo/CresgNeo (Mus musculus)Mammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR Winslow Pancreatic cancer modeling using retrograde viral vector delivery and in vivo CRISPR/Cas9-mediated somatic genome editing. Genes Dev. 2015 Jul 15;29(14):1576-85. doi: 10.1101/gad.264861.115. Epub 2015 Jul 15. Expresses an Neomycin-targeting gRNA and Cre-recombinase pLL3.3 Add to Cart
    pKLV2-U6gRNA5(gBFP)-PGKGFP2ABFP-WU6gRNA cassette, PGKGFP2ABFP cassette, WPRE (Homo sapiens), Guide RNA targeting modified BFPLentiviral, CRISPR Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Cas9 activity reporter with GFP and BFP pKLV2 lentiviral vector Add to Cart
    pKLV2-U6gRNA5(gBFP)-PGKmCherry2ABFP-WU6gRNA cassette, PGKmCherryABFP cassette, WPRE (Homo sapiens), Guide RNA targeting modified BFP (Synthetic)Lentiviral, CRISPR Yusa A CRISPR Dropout Screen Identifies Genetic Vulnerabilities and Therapeutic Targets in Acute Myeloid Leukemia. Cell Rep. 2016 Oct 18;17(4):1193-1205. doi: 10.1016/j.celrep.2016.09.079. Cas9 activity reporter with mCherry and BFP pKLV2 lentiviral vector Add to Cart
    p426-SNR52p-gRNA.csr-1.Y-SUP4tgRNA for csr-1 locus (Other)Yeast Expression, CRISPR ; N. crassa, Fungi Hong Efficient gene editing in Neurospora crassa with CRISPR technology Fungal Biology and Biotechnology 2015, 2:4 gRNA for csr-1 locus in N. crassa pRS426 Add to Cart
    pICSL11057Promote:TaU6+sgRNA HvPM19_1 (Other)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. Level 1 Golden Gate Cassette: sgRNA cassette targeting PM19_1 in barley pICH47761 (AddGene #48003) Add to Cart
    pICSL11058Promoter_TaU6 + sgRNA_HvPM19_3 (Other)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. Level 1 Golden Gate Cassette: sgRNA cassette targeting PM19_3 in barley pICH47761 (AddGene #48003) Add to Cart
    pICSL11061Promoter_AtU6-26 + sgRNA_BolC.GA4a-1 (Arabidopsis thaliana)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. Level 1 Golden Gate Cassette: sgRNA cassette targeting BolC.GA4a-1 in Brassica oleracea pICH47751 (AddGene #48002) Add to Cart
    pICSL11062Promoter_AtU6-26 + sgRNA_BolC.GA4a-2 (Arabidopsis thaliana)Plant Expression, Synthetic Biology Patron Induction of targeted, heritable mutations in barley and Brassica oleracea using RNA-guided Cas9 nuclease. Genome Biol. 2015 Nov 30;16(1):258. doi: 10.1186/s13059-015-0826-7. Level 1 Golden Gate Cassette: sgRNA cassette targeting BolC.GA4a-2 in Brassica oleracea pICH47761 (AddGene #48003) Add to Cart
    pU6_(GLuc)_sgRNAGluc sgRNA (Synthetic)Mammalian Expression, CRISPR Rinn Multiplexable, locus-specific targeting of long RNAs with CRISPR-Display. Nat Methods. 2015 Jul;12(7):664-70. doi: 10.1038/nmeth.3433. Epub 2015 Jun 1. Transient expression of a minimal sgRNA targeting the GLuc reporter, in mammalian cells. U6 promoter pNEB193 Add to Cart
    PAX6 sgRNA2sgRNA targeting PAX6 (Homo sapiens)Mammalian Expression, CRISPR Zhang Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. targeting PAX6 gene Cas9 sgRNA vevctor Add to Cart
    PAX6 sgRNA7sgRNA targeting PAX6 (Homo sapiens)Mammalian Expression, CRISPR Zhang Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell Stem Cell. 2015 Jul 1. pii: S1934-5909(15)00261-1. doi: 10.1016/j.stem.2015.06.001. targeting PAX6 gene Cas9 sgRNA vevctor Add to Cart
    pX330-sgRNA_Dicer_1sgRNA mouse Dicer1 (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb. specific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs. pX330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    pX330-sgRNA_Dicer_2sgRNA mouse Dicer1 (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb. specific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of pX330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    pX330-sgRNA_Dicer_3sgRNA mouse Dicer1 (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Dicer, a new regulator of pluripotency exit and LINE-1 elements in mouse embryonic stem cells. FEBS Open Bio. 2017 Jan 11;7(2):204-220. doi: 10.1002/2211-5463.12174. eCollection 2017 Feb. specific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs. pX330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    pMM704dCas9, LacI, sgRNA Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 IPTG-inducible CRISPRi vector targeting BT1854, pNBU2 backbone, AmpR pExchange-tdk Add to Cart
    pMM705dCas9, LacI, sgRNA Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 IPTG-inducible CRISPRi vector targeting BT1754, pNBU2 backbone, AmpR pExchange-tdk Add to Cart
    pMM710dCas9, LacI, sgRNA Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 IPTG-inducible CRISPRi vector targeting nonsense sequence (NS), pNBU2 backbone, AmpR pExchange-tdk Add to Cart
    pMM725dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 IPTG-inducible CRISPRi vector targeting NanoLuc (NL3), constiutive NanoLuc, pNBU2 backbone, AmpR pExchange-tdk Add to Cart
    pMM731dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 IPTG-inducible CRISPRi vector targeting NanoLuc (NL1), constiutive NanoLuc, pNBU2 backbone, AmpR pNBU2 Add to Cart
    pMM732dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 IPTG-inducible CRISPRi vector targeting NanoLuc (NL2), constiutive NanoLuc, pNBU2 backbone, AmpR pNBU2 Add to Cart
    pMM733dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 IPTG-inducible CRISPRi vector targeting NanoLuc (NL4), constiutive NanoLuc, pNBU2 backbone, AmpR pNBU2 Add to Cart
    pMM750dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 IPTG-inducible CRISPRi vector targeting PcfiA (PR2), constiutive NanoLuc, pNBU2 backbone, AmpR pNBU2 Add to Cart
    pMM763dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 IPTG-inducible CRISPRi vector targeting PcfiA (PR1), constiutive NanoLuc, pNBU2 backbone, AmpR pNBU2 Add to Cart
    pMM764dCas9, LacI, sgRNA, NanoLuc Lu Programming a Human Commensal Bacterium, Bacteroides thetaiotaomicron, to Sense and Respond to Stimuli in the Murine Gut Microbiota Cell Systems, 2015 IPTG-inducible CRISPRi vector targeting nonsense sequence (NS), constiutive NanoLuc, pNBU2 backbone, AmpR pNBU2 Add to Cart
    pLKO1-puro-U6-sgRNA-TS2TS2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. U6 driven SpCas9 sgRNA expression for TS2 site pLKO.1 Add to Cart
    pLKO1-puro-U6-sgRNA-TS3TS3 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. U6 driven SpCas9 sgRNA expression for TS3 site pLKO.1 Add to Cart
    pLKO1-puro-U6-sgRNA-TS4TS4 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. U6 driven SpCas9 sgRNA expression for TS4 site pLKO.1 Add to Cart
    pLKO1-puro-U6-sgRNA-LRTM2LRTM2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. U6 driven SpCas9 sgRNA expression for LRTM2 site pLKO.1 LRTM2 Add to Cart
    pLKO1-puro-U6-sgRNA-KANK3KANK3 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. U6 driven SpCas9 sgRNA expression for KANK3 site pLKO.1 KANK3 ANKRD47 Add to Cart
    pLKO1-puro-U6-sgRNA-TGM2TGM2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. U6 driven SpCas9 sgRNA expression for TGM2 site pLKO.1 TGM2 TG(C), TGC Add to Cart
    pLKO1-puro-U6-sgRNA-PLXNB2PLXNB2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Wolfe DNA-binding-domain fusions enhance the targeting range and precision of Cas9. Nat Methods. 2015 Oct 19. doi: 10.1038/nmeth.3624. U6 driven SpCas9 sgRNA expression for PLXNB2 site pLKO.1 PLXNB2 MM1, Nbla00445, PLEXB2, dJ402G11.3 Add to Cart
    GG-EBNA-OCT45 concatenated gRNA transcriptional cassettes targeting OCT4CRISPR Otonkoski Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation. Stem Cell Reports. 2015 Sep 8;5(3):448-59. doi: 10.1016/j.stemcr.2015.08.001. Episomal plasmid encoding 5 gRNAS targeting human OCT4 promoter GGdest Add to Cart
    HPRT2b-pGEMHPRT gRNA2 (Homo sapiens)Mammalian Expression Yan Enriching CRISPR-Cas9 targeted cells by co-targeting the HPRT gene. Nucleic Acids Res. 2015 Jun 29. pii: gkv675. gRNA targeting human HPRT gene pGEM Add to Cart
    pX330-mitfmitf-sgRNA (Other), SpCas9 (Synthetic)Mammalian Expression Zhao Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs. Sci Rep. 2015 Aug 21;5:13348. doi: 10.1038/srep13348. Used to make mitf knockout porcine cell line px330 (Addgene 42230) Add to Cart
    CRISPRmTmG2gRNA that targets near LoxP sites Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21. The CRISPR construct targets near the LoxP sites in Rosa-pCA-loxP-mTdtomato-loxP-mEGFP mice. px330 (Addgene 42230) Add to Cart
    pTC217Nuclease (Cas9/sgRNA) + Donor + GVR (Other)Plant Expression, CRISPR Voytas High-frequency, precise modification of the tomato genome. Genome Biol. 2015 Nov 6;16(1):232. doi: 10.1186/s13059-015-0796-9. Cas9/sgRNA targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based on Bean Yellow Dwarf Virus; sgRNA= 1b pLSLR Add to Cart
    pTC223Nuclease (Cas9/sgRNA) + Donor + GVR (Other)Plant Expression, CRISPR Voytas High-frequency, precise modification of the tomato genome. Genome Biol. 2015 Nov 6;16(1):232. doi: 10.1186/s13059-015-0796-9. Cas9/sgRNA targeting ANT1 locus, donor molecule with 5' homology arm-Pnos:NptII-35S:ANT13' homology arm as a Gemini Viral Replicon based on Bean Yellow Dwarf Virus; sgRNA= 7 pLSLR Add to Cart
    AP568-2sgRNA for dpy‐10Worm Expression, CRISPR Seydoux High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 2015 Sep;201(1):47-54. doi: 10.1534/genetics.115.179382. Epub 2015 Jul 17. co-expression of Cas9 and crRNA 589 target sequence pDD162 Add to Cart
    AP568-3sgRNA for dpy‐10Worm Expression, CRISPR Seydoux High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 2015 Sep;201(1):47-54. doi: 10.1534/genetics.115.179382. Epub 2015 Jul 17. co-expression of Cas9 and crRNA 589 target sequence pDD162 Add to Cart
    lentiCRISPR - C16orf80 sgRNA 2sgRNA against C16orf80Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C16orf80 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR v1 Add to Cart
    lentiCRISPR - C16orf80 sgRNA 1sgRNA against C16orf80Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C16orf80 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR v1 Add to Cart
    lentiCRISPR - C3orf17 sgRNA 1sgRNA against C3orf17Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C3orf17 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR v1 Add to Cart
    lentiCRISPR - C3orf17 sgRNA 2sgRNA against C3orf17Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C3orf17 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR v1 Add to Cart
    lentiCRISPR - C9orf114 sgRNA 2sgRNA against C9orf114Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR v1 Add to Cart
    lentiCRISPR - C9orf114 sgRNA 1 sgRNA against C9orf114Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a C9orf114 targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR v1 Add to Cart
    lentiCRISPR - DDX3Y sgRNA 1sgRNA against DDX3YMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR v1 Add to Cart
    lentiCRISPR - DDX3Y sgRNA 2sgRNA against DDX3YMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a DDX3Y targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone. lentiCRISPR v1 Add to Cart
    lentiCRISPR - Amplicon, BCR/ABL sgRNA 2sgRNA against BCR/ABLamplicon found in CML-derived K562 cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backbone. lentiCRISPR v1 Add to Cart
    lentiCRISPR - Amplicon, BCR/ABL sgRNA 1sgRNA against BCR/ABLamplicon found in CML-derived K562 cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backbone lentiCRISPR v1 Add to Cart
    lentiCRISPR - Amplicon, JAK2 sgRNA 2sgRNA against JAK2 amplicon found in AML-derived HEL cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backbone lentiCRISPR v1 JAK2 JTK10, THCYT3 Add to Cart
    lentiCRISPR - AAVS1 sgRNAsgRNA against AAVS1Mammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backbone lentiCRISPR v1 Add to Cart
    lentiCRISPR - CTRL sgRNAnon-targeting sgRNAMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a non-targeting sgRNA element from U6 promoter. Lentiviral backbone lentiCRISPR v1 Add to Cart
    lentiCRISPR - Amplicon, JAK2 sgRNA 1 sgRNA against JAK2 amplicon found in AML-derived HEL cell lineMammalian Expression, Lentiviral, CRISPR Sabatini Identification and characterization of essential genes in the human genome. Science. 2015 Oct 15. pii: aac7041. Expresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backbone lentiCRISPR v1 JAK2 JTK10, THCYT3 Add to Cart
    pHEE2E-TRIsgRNA targeting TRY and CPC genes (Synthetic), sgRNA targeting ETC2 gene (Synthetic), zCas9 (Other)Plant Expression, CRISPR ; Plant binary vector Chen Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol. 2015 Jul 21;16:144. doi: 10.1186/s13059-015-0715-0. Egg cell-specific promoter-controlled expression 3×FLAG-NLS-zCas9-NLS and two sgRNAs targeting three genes: ETC2, TRY, and CPC pCambia Add to Cart
    pRB1081dpy-10 gRNA (Synthetic)Worm Expression, CRISPR Fire Cas9 Variants Expand the Target Repertoire in Caenorhabditis elegans. Genetics. 2015 Dec 17. pii: genetics.115.185041. Expresses gRNA for dpy-10 conversion using NGAG PAM and VQR Cas9 variant pRB1017 Add to Cart
    sgPal1 (p2Tol-U6-sgPal1-HygR)sgPal1 Sherwood Cloning-free CRISPR. Stem Cell Reports. 2015 Oct 27. pii: S2213-6711(15)00284-2. doi: 10.1016/j.stemcr.2015.09.022. Expresses palindromic sgRNA for use in self-cloning CRISPR p2Tol2 Add to Cart
    sgPal7 (p2Tol-U6-sgPal7-HygR)sgPal7 Sherwood Cloning-free CRISPR. Stem Cell Reports. 2015 Oct 27. pii: S2213-6711(15)00284-2. doi: 10.1016/j.stemcr.2015.09.022. Expresses palindromic sgRNA for use in self-cloning CRISPR p2Tol2 Add to Cart
    pRB1084dpy-10 gRNA (Synthetic)Worm Expression, CRISPR Fire Cas9 Variants Expand the Target Repertoire in Caenorhabditis elegans. Genetics. 2015 Dec 17. pii: genetics.115.185041. Expresses gRNA for dpy-10 conversion using NGCG PAM and VRER Cas9 mutant pRB1017 Add to Cart
    pdCas9-DNMT3A-PuroR_BACH2-sgRNA8BACH2-sgRNA8 (Homo sapiens)Mammalian Expression, CRISPR Zoldoš Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Res. 2016 Mar 11. pii: gkw159. Expression of dCas9-DNMT3A fusion with T2A-PuroR and specific sgRNA for targeted DNA methylation of BACH2 promoter in human cells; for use as a control pdCas9-DNMT3A-PuroR BACH2 BTBD25 Add to Cart
    pdCas9-DNMT3A-PuroR_BACH2-sgRNA8 (ANV)BACH2-sgRNA8 (Homo sapiens)Mammalian Expression, CRISPR Zoldoš Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Res. 2016 Mar 11. pii: gkw159. Expression of mutant dCas9-DNMT3A fusion (inactive catalytic domain of DNMT3A) with T2A-PuroR and specific sgRNA for the human BACH2 promoter; for use as a control pdCas9-DNMT3A-PuroR (ANV) BACH2 BTBD25 Add to Cart
    pdCas9-DNMT3A-PuroR_hNTNon-targeting sgRNA human (Homo sapiens)Mammalian Expression, CRISPR Zoldoš Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Res. 2016 Mar 11. pii: gkw159. Expression of dCas9-DNMT3A fusion with T2A-PuroR and non-targeting control sgRNA for use in human cells pdCas9-DNMT3A-PuroR Add to Cart
    pDECKO_GFPgRNAs toward GFP (Synthetic)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. Expresses two gRNAs targeting GFP Lenti-guide puro Add to Cart
    pDECKO_Malat1_AgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. Expresses two gRNAs targeting MALAT1 promoter Lentiguide-puro Add to Cart
    pDECKO_Malat1_BgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. Expresses two gRNAs targeting MALAT1 promoter Lentiguide-puro Add to Cart
    pDECKO_Malat1_CgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. Expresses two gRNAs targeting MALAT1 promoter Lentiguide-puro Add to Cart
    pDECKO_Malat1_DgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. Expresses two gRNAs targeting MALAT1 promoter Lentiguide-puro Add to Cart
    pDECKO_Malat1_EgRNAs toward Malat1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. Expresses two gRNAs targeting MALAT1 promoter Lentiguide-puro Add to Cart
    pDECKO_TFRC_BgRNAs toward TFRC (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. Expresses two gRNAs targeting the TFRC promoter Lentiguide-puro Add to Cart
    pDECKO_TFRC_C (with mCherry)gRNAs toward TFRC (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. Expresses two gRNAs targeting the TFRC promoter pDECKO-mCherry Add to Cart
    pDECKO_UCA1gRNAs toward UCA1 (Homo sapiens)Mammalian Expression Guigo DECKO: Single-oligo, dual-CRISPR deletion of genomic elements including long non-coding RNAs. BMC Genomics. 2015 Oct 23;16(1):846. doi: 10.1186/s12864-015-2086-z. Expresses two gRNAs targeting the UCA1 promoter Lentiguide-puro Add to Cart
    AAVS1 T2 CRIPR in pX330Cas9 and gRNA for targeting the AAVS1 locus in human cells (Homo sapiens)Mammalian Expression, CRISPR Kanemaki Rapid Protein Depletion in Human Cells by Auxin-Inducible Degron Tagging with Short Homology Donors. Cell Rep. 2016 Apr 5;15(1):210-8. doi: 10.1016/j.celrep.2016.03.001. Epub 2016 Mar 24. CRISPR/Cas to target the AAVS1 locus in human cells pX330 Add to Cart
    pT7-gRNA_zebrafish_mmp21zebrafish mmp21 (Danio rerio)CRISPR Katsanis A human laterality disorder caused by a homozygous deleterious mutation in MMP21. J Med Genet. 2015 Dec;52(12):840-7. doi: 10.1136/jmedgenet-2015-103336. Epub 2015 Oct 1. plasmid to generate guideRNA against mmp21 gene in zebrafish pT7-gRNA Add to Cart
    pMD19T-slr0230-PL31-sgRNANT1-KmRPL31-sgRNA NT1Bacterial Expression Hudson Multiple Gene Repression in Cyanobacteria Using CRISPRi. ACS Synth Biol. 2015 Dec 28. Contains sgRNA which targets GFPmut3b. Under an aTc inducible promoter. Suicide vector inserts into slr0230 site of Synechocystis. Carries kanamycin resistance. Propogates in E. coli pMD19T simple Add to Cart
    pMD19T-slr0230-PL22-sgRNANT1-KmRPL22-sgRNA NT1Bacterial Expression Hudson Multiple Gene Repression in Cyanobacteria Using CRISPRi. ACS Synth Biol. 2015 Dec 28. Contains sgRNA which targets GFPmut3b. Under an aTc inducible promoter. Suicide vector inserts into slr0230 site of Synechocystis. Carries kanamycin resistance. Propogates in E. coli pMD19T simple Add to Cart
    pNICKclos2.0Cas9 nickase (Other), sgRNA to xylR (Synthetic)E.coli - clostridium shuttle vector Yang CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053. Genome editing for gene xylR (cbei-2385) in clostridium beijerinckii NCIMB 8052 pXY1 Add to Cart
    pCfB3020(gRNA X-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-2 pESC-Leu Add to Cart
    pCfB3041(gRNA X-3)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-3 pESC-Leu Add to Cart
    pCfB3042(gRNA X-4)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-2 pESC-Leu Add to Cart
    pCfB3043(gRNA XI-1)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-1 pESC-Leu Add to Cart
    pCfB3044(gRNA XI-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-2 pESC-Leu Add to Cart
    pCfB3045(gRNA XI-3)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-3 pESC-Leu Add to Cart
    pCfB3046(gRNA XI-5)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XI-5 pESC-Leu Add to Cart
    pCfB3047(gRNA XII-1)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-1 pESC-Leu Add to Cart
    pCfB3048(gRNA XII-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-2 pESC-Leu Add to Cart
    pCfB3049(gRNA XII-4)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-4 pESC-Leu Add to Cart
    pCfB3050(gRNA XII-5)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-5 pESC-Leu Add to Cart
    pCfB3051(gRNA X-3 XI-2 XII-2)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-3, XI-2, and XII-2 pESC-Leu Add to Cart
    pCfB3052(gRNA X-4, XI-3, XII-5)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5 pESC-Leu Add to Cart
    pCfB3053(gRNA X-2, XI-5, XII-4)guiding RNA (Saccharomyces cerevisiae)Yeast Expression, CRISPR ; gRNA Borodina EasyClone-MarkerFree: A vector toolkit for marker-less integration of genes into Saccharomyces cerevisiae via CRISPR-Cas9. Biotechnol J. 2016 Aug;11(8):1110-7. doi: 10.1002/biot.201600147. Epub 2016 Jun 23. EasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-2, XI-5, and XII-4 pESC-Leu Add to Cart
    pdCas9-M-C4Repressor C4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant C4. pdCas9 Add to Cart
    pdCas9-M-3F2Repressor C4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2. pdCas9 Add to Cart
    pdCas9-M-3H5Repressor 3H5 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5. pdCas9 Add to Cart
    pdCas9-M-1B6Repressor 1B6 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6. pdCas9 Add to Cart
    pdCas9-M-4F2Repressor 4F2 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2. pdCas9 Add to Cart
    pdCas9-M-5F5Repressor 5F5 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5. pdCas9 Add to Cart
    pdCas9-M-1D4Repressor 1D4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4. pdCas9 Add to Cart
    pdCas9-M-4A6Repressor 4A6 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6. pdCas9 Add to Cart
    pdCas9-M-3A2Repressor 3A2 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2. pdCas9 Add to Cart
    pdCas9-M-1E4Repressor 1E4 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4. pdCas9 Add to Cart
    pdCas9-M-G6Repressor G6 (orthogonal T7-lac repressor) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Koffas Rapid generation of CRISPR/dCas9-regulated, orthogonally repressible hybrid T7-lac promoters for modular, tuneable control of metabolic pathway fluxes in Escherichia coli. Nucleic Acids Res. 2016 Apr 13. pii: gkw231. CRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant G6. pdCas9 Add to Cart
    pX330-sgRNA_Dgcr8_1DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073. Expresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8 X330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    pX330-sgRNA_Dgcr8_2DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073. Expresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8 X330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    pX330-sgRNA_Dgcr8_3DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073. Expresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8 X330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    pX330-sgRNA_Dgcr8_4DGCR8 (Mus musculus)Mammalian Expression, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073. Expresses a human codon-optimized SpCas9 and sgRNA targeting Dgcr8 X330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    pNICKclos1.0Cas9 nickase (Other), sGRNA to pyrEE.coli-clostridium shuttle vector Yang CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053. Genome editing for gene pyrE (CAC-002) in Clostridium acetobutylicum ATCC 824 pIMP1-ptb Add to Cart
    pdCASclosdCas9 (Other), sgRNA to spo0AE.coli-clostridium shuttle vector Yang CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnol J. 2016 May 23. doi: 10.1002/biot.201600053. Transcriptional repression for gene Spo0A (CAC-2011) in Clostridium acetobutylicum ATCC 824 pIMP1-ptb Add to Cart
    B31gRNA (Mus musculus)CRISPR Cepko A gene regulatory network controls the binary fate decision of rod and bipolar cells in the vertebrate retina. Dev Cell. 2014 Sep 8;30(5):513-27. doi: 10.1016/j.devcel.2014.07.018. Epub 2014 Aug 21. gRNA for B108 px330 Add to Cart
    pAL-pgi_TsgRNA pgi (T)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16. pAL374 plasmid carrying the pgi (T) sgRNA, targeting the template strand of pgi, SpecR pAL374 Add to Cart
    pAL-pgi_NTsgRNA pgi (NT) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16. pAL374 plasmid carrying the pgi (NT) sgRNA, targeting the non-template strand of pgi, SpecR pAL374 Add to Cart
    pAL-pck_TsgRNA pck (T) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16. pAL374 plasmid carrying the pck (T) sgRNA targeting, the template strand of pck, SpecR pAL374 Add to Cart
    pAL-pck_NTsgRNA pck (NT) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16. pAL374 plasmid carrying the pck (NT) sgRNA, targeting the non-template strand of pck, SpecR pAL374 Add to Cart
    pAL-pyk_TsgRNA pyk (T) (Synthetic)Bacterial Expression, CRISPR, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16. pAL374 plasmid carrying the pyk (T) sgRNA targeting the template strand of pyk, SpecR pAL374 Add to Cart
    pAL-pyk_NTsgRNA pyk (NT) (Synthetic)Bacterial Expression, CRISPR Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16. pAL374 plasmid carrying the pyk (NT) sgRNA targeting the non-template strand of pyk, SpecR pAL374 Add to Cart
    pAL-rfp_TsgRNA rfp (T) (Synthetic)Bacterial Expression, Synthetic Biology Lu Corynebacterium glutamicum Metabolic Engineering with CRISPR Interference (CRISPRi). ACS Synth Biol. 2016 Feb 16. pAL374 plasmid carrying the rfp (T) sgRNA targeting the template strand of rfp, SpecR pAL374 Add to Cart
    pLCKO_LacZ_sgRNALacZ sgRNA (Other)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25. lentiviral vector expressing sgRNA targeting LacZ pLCKO Add to Cart
    pLCKO_PSMD1_sgRNA_1PSMD1 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25. lentiviral vector expressing sgRNA targeting PSMD1 pLCKO Add to Cart
    pLCKO_PSMD1_sgRNA_5PSMD1 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25. lentiviral vector expressing sgRNA targeting PSMD1 pLCKO Add to Cart
    pLCKO_PSMB2_sgRNA_1PSMB2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25. lentiviral vector expressing sgRNA targeting PSMB2 pLCKO Add to Cart
    pLCKO_PSMB2_sgRNA_5PSMB2 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25. lentiviral vector expressing sgRNA targeting PSMB2 pLCKO Add to Cart
    pLCKO_EIF3D_sgRNA_1EIF3D sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25. lentiviral vector expressing sgRNA targeting EIF3D pLCKO Add to Cart
    pLCKO_EIF3D_sgRNA_4EIF3D sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25. lentiviral vector expressing sgRNA targeting EIF3D pLCKO Add to Cart
    pLCKO_Luciferase_sgRNALuciferase sgRNA (Other)Mammalian Expression, Lentiviral, CRISPR Moffat High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 2015 Dec 3;163(6):1515-26. doi: 10.1016/j.cell.2015.11.015. Epub 2015 Nov 25. lentiviral vector expressing sgRNA targeting Luciferase pLCKO Add to Cart
    pMOD8A-iRGR-r11RGR-r11 (Synthetic)Yeast Expression, CRISPR, Synthetic Biology Klavins Robust digital logic circuits in eukaryotic cells with CRISPR/dCas9 NOR gates bioRxiv, 2016 This plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function. pMOD8 Add to Cart
    pMOD8A-RGR-r10RGR-r10 (Synthetic)Yeast Expression, CRISPR, Synthetic Biology Klavins Robust digital logic circuits in eukaryotic cells with CRISPR/dCas9 NOR gates bioRxiv, 2016 This plasmid constitutively expresses gRNA-r10 from an AHD1 promoter using the RGR design. Integrates in the W303 HIS locus and restores HIS function. pMOD8 Add to Cart
    pX462-hPRKAA1-gRNA_Ahuman AMPK alpha 1 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138. gRNA_A to knockout human AMPK alpha 1 using Cas9n pX462 PRKAA1 AMPK, AMPKa1 Add to Cart
    pX462-hPRKAA1-gRNA_Bhuman AMPK alpha 1 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138. gRNA_B to knockout human AMPK alpha 1 using Cas9n pX462 PRKAA1 AMPK, AMPKa1 Add to Cart
    pX462-hPRKAA2-gRNA_Ahuman AMPK alpha 2 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138. gRNA_A to knockout human AMPK alpha 2 using Cas9n. pX462 PRKAA2 AMPK, AMPK2, AMPKa2, PRKAA Add to Cart
    pX462-hPRKAA2-gRNA_Bhuman AMPK alpha 2 exon1 gRNA (Homo sapiens)CRISPR Shaw Metabolism. AMP-activated protein kinase mediates mitochondrial fission in response to energy stress. Science. 2016 Jan 15;351(6270):275-81. doi: 10.1126/science.aab4138. gRNA_B to knockout human AMPK alpha 2 using Cas9n pX462 PRKAA2 AMPK, AMPK2, AMPKa2, PRKAA Add to Cart
    pBluescriptSKII+ U6-sgRNA(F+E) ACTBU6 promoter driving sgRNA targeting the 3'UTR of ACTB mRNAMammalian Expression, CRISPR Yeo Programmable RNA Tracking in Live Cells with CRISPR/Cas9. Cell. 2016 Mar 16. pii: S0092-8674(16)30204-5. doi: 10.1016/j.cell.2016.02.054. Encodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and a spacer targeting the 3'UTR of ACTB mRNA pBlueScript II SK(+) Add to Cart
    pBluescriptSKII+ U6-sgRNA(F+E) TFRCU6 promoter driving sgRNA targeting the 3'UTR of TFRC mRNAMammalian Expression, CRISPR Yeo Programmable RNA Tracking in Live Cells with CRISPR/Cas9. Cell. 2016 Mar 16. pii: S0092-8674(16)30204-5. doi: 10.1016/j.cell.2016.02.054. Encodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and a spacer targeting the 3'UTR of TFRC mRNA pBlueScript II SK(+) Add to Cart
    pLC-EGFP-RIP1RIPK1 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. LentiCRISPR-EGFP with sgRNA targeting human RIPk1 lentiCRISPRv1 Add to Cart
    pLC-RFP657-CASP8CASP8 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. LentiCRISPR-RFP657 with sgRNA targeting human Caspase-8 lentiCRISPRv1 CASP8 ALPS2B, CAP4, Casp-8, FLICE, MACH, MCH5 Add to Cart
    pLC-EGFP-RIP3RIP3 sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. LentiCRISPR-EGFP with sgRNA targeting human RIP3 lentiCRISPRv1 Add to Cart
    pLC-BFP-FADDFADD sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. LentiCRISPR-BFP with sgRNA targeting human FADD lentiCRISPRv1 FADD GIG3, MORT1 Add to Cart
    pLC-mCherry-MLKLMLKL sgRNA (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Bornhauser Activation of concurrent apoptosis and necroptosis by SMAC mimetics for the treatment of refractory and relapsed ALL. Sci Transl Med. 2016 May 18;8(339):339ra70. doi: 10.1126/scitranslmed.aad2986. LentiCRISPR-mCherry with sgRNA targeting human MLKL lentiCRISPRv1 Add to Cart
    NFATc1-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 plasmid against human NFATc1 PX458-pSpCas9(BB)2A-GFP NFATC1 NF-ATC, NF-ATc1.2, NFAT2, NFATc Add to Cart
    NFATc1-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 plasmid against human NFATc1 PX458-pSpCas9(BB)2A-GFP NFATC1 NF-ATC, NF-ATc1.2, NFAT2, NFATc Add to Cart
    NFATc1-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 NICKASE plasmid against human NFATc1 (1/2) PX461-pSpCas9n(BB)2A-GFP NFATC1 NF-ATC, NF-ATc1.2, NFAT2, NFATc Add to Cart
    NFATc1-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against NFATc1 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 NICKASE plasmid against human NFATc1 (2/2) PX461-pSpCas9n(BB)2A-GFP NFATC1 NF-ATC, NF-ATc1.2, NFAT2, NFATc Add to Cart
    NFATc2-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against human NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 plasmid against human NFATc2 PX458-pSpCas9(BB)2A-GFP NFATC2 NFAT1, NFATP Add to Cart
    NFATc2-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against human NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 plasmid against human NFATc2 PX458-pSpCas9(BB)2A-GFP NFATC2 NFAT1, NFATP Add to Cart
    NFATc2-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 NICKASE plasmid against human NFATc2 (1/2) PX461-pSpCas9n(BB)2A-GFP NFATC2 NFAT1, NFATP Add to Cart
    NFATc2-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human NFATc2 (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 NICKASE plasmid against human NFATc2 (2/2) PX461-pSpCas9n(BB)2A-GFP NFATC2 NFAT1, NFATP Add to Cart
    Ikaros-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 plasmid against human Ikaros PX458-pSpCas9(BB)2A-GFP IKZF1 CVID13, Hs.54452, IK1, IKAROS, LYF1, LyF-1, PPP1R92, PRO0758, ZNFN1A1 Add to Cart
    Ikaros-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 plasmid against human Ikaros PX458-pSpCas9(BB)2A-GFP IKZF1 CVID13, Hs.54452, IK1, IKAROS, LYF1, LyF-1, PPP1R92, PRO0758, ZNFN1A1 Add to Cart
    Ikaros-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 NICKASE plasmid against human Ikaros (1/2) PX461-pSpCas9n(BB)2A-GFP IKZF1 CVID13, Hs.54452, IK1, IKAROS, LYF1, LyF-1, PPP1R92, PRO0758, ZNFN1A1 Add to Cart
    Ikaros-CRISPR-Nick2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Ikaros (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 NICKASE plasmid against human Ikaros (2/2) PX461-pSpCas9n(BB)2A-GFP IKZF1 CVID13, Hs.54452, IK1, IKAROS, LYF1, LyF-1, PPP1R92, PRO0758, ZNFN1A1 Add to Cart
    Helios-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)sgRNA against human Helios (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 plasmid against human Helios PX458-pSpCas9(BB)2A-GFP IKZF2 ANF1A2, HELIOS, ZNF1A2, ZNFN1A2 Add to Cart
    Helios-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Helios (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 NICKASE plasmid against human Helios (1/2) PX461-pSpCas9n(BB)2A-GFP IKZF2 ANF1A2, HELIOS, ZNF1A2, ZNFN1A2 Add to Cart
    Helios-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)sgRNA against human Helios (Homo sapiens)CRISPR Baumgrass Identification of Novel Nuclear Factor of Activated T Cells (NFAT)-Associated Proteins in T cells. J Biol Chem. 2016 Sep 16. pii: jbc.M116.739326. CRISPR/Cas9 NICKASE plasmid against human Helios (2/2) PX461-pSpCas9n(BB)2A-GFP IKZF2 ANF1A2, HELIOS, ZNF1A2, ZNFN1A2 Add to Cart
    pLH-sgRNA1sgRNA1 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1 pLKO.1 Add to Cart
    pLH-sgRNA1-2XMS2sgRNA1-2XMS2 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-2XMS2 pLKO.1 Add to Cart
    pLH-sgRNA1-2XPP7sgRNA1-2XPP7 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-2XPP7 pLKO.1 Add to Cart
    pLH-sgRNA1-2XboxBsgRNA1-2XboxB (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-2XboxB pLKO.1 Add to Cart
    pLH-sgRNA1-MS2-PP7sgRNA1-2XMS2-PP7 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-MS2-PP7 pLKO.1 Add to Cart
    pLH-sgRNA1-PP7-boxBsgRNA1-2XPP7-boxB (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-PP7-boxB pLKO.1 Add to Cart
    pLH-sgRNA1-boxB-MS2sgRNA1-boxB-MS2 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-boxB-MS2 pLKO.1 Add to Cart
    pLH-sgRNA1-boxB-MS2-PP7sgRNA1-boxB-MS2-PP7 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Pederson Multiplexed labeling of genomic loci with dCas9 and engineered sgRNAs using CRISPRainbow. Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526. sgRNA1-boxB-MS2-PP7 pLKO.1 Add to Cart
    sgTP53_3TP53 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Hahn Integrated genetic and pharmacologic interrogation of rare cancers. NATURE COMMUNICATIONS 7:11987 sgTP53 lentiGuide-Puro TP53 BCC7, LFS1, P53, TRP53 Add to Cart
    sgGFP_3GFPMammalian Expression, Lentiviral, CRISPR Hahn Integrated genetic and pharmacologic interrogation of rare cancers. NATURE COMMUNICATIONS 7:11987 sgGFP lentiGuide-Puro Add to Cart
    USP19 sgRNA1USP19 sgRNA1 (Homo sapiens)Mammalian Expression, CRISPR Ye Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13. delete USP19 gene in human cell pX330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    USP19 sgRNA2USP19 sgRNA2 (Homo sapiens)Mammalian Expression, CRISPR Ye Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13. delete USP19 gene in human cell pX330-U6-Chimeric_BB-CBh-hSpCas9 USP19 ZMYND9 Add to Cart
    pX330_HR_Prnp_3pX330_HR_Prnp_3 (Mus musculus)Mammalian Expression, Mouse Targeting, CRISPR Jackson Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016. pX330 vector encoding SpCas9 and a chimeric guide RNA targeting Prnp coding sequence pX330 Add to Cart
    pX335_HR_Prnp_3HR_Prnp_3 (Mus musculus)Mammalian Expression, Mouse Targeting, CRISPR Jackson Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016. pX335 vector encoding SpCas9n and a chimeric guide RNA targeting Prnp coding sequence pX335 Add to Cart
    pX459_HR_Prnp_3HR_Prnp_3 (Mus musculus)Mammalian Expression, Mouse Targeting, CRISPR Jackson Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016. pX459 vector encoding SpCas9-2A-Puro and a chimeric guide RNA targeting Prnp coding sequence pX459 Add to Cart
    sgRNA(MS2)_Prnp_SAM1sgRNA(MS2)_Prnp_SAM1 (Mus musculus)Mammalian Expression, CRISPR Jackson Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016. Encodes sgRNA2.0 targeting 158nt upstream of TSS sgRNA(MS2) Add to Cart
    sgRNA(MS2)_Prnp_SAM2sgRNA(MS2)_Prnp_SAM2 (Mus musculus)Mammalian Expression, CRISPR Jackson Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. PLoS One. 2016 Apr 29;11(4):e0154604. doi: 10.1371/journal.pone.0154604. eCollection 2016. Encodes sgRNA2.0 targeting 138nt upstream of TSS sgRNA(MS2) Add to Cart
    Cas9-GFP_sg_mAMPKa1Prkaa1 (Mus musculus)Mammalian Expression, CRISPR Shaw AMPK governs lineage specification through Tfeb-dependent regulation of lysosomes. Genes Dev. 2016 Mar 1;30(5):535-52. doi: 10.1101/gad.274142.115. Expresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 1. pSpCas9(BB)-2A-GFP (PX458) Prkaa1 AI194361, AI450832, AL024255, AMPKalpha1, C130083N04Rik Add to Cart
    Cas9-GFP_sg_mAMPKa2Prkaa2 (Mus musculus)Mammalian Expression, CRISPR Shaw AMPK governs lineage specification through Tfeb-dependent regulation of lysosomes. Genes Dev. 2016 Mar 1;30(5):535-52. doi: 10.1101/gad.274142.115. Expresses WT Cas9 and GFP, along with a sgRNA to mouse AMPK alpha 2. pSpCas9(BB)-2A-GFP (PX458) Prkaa2 2310008I11Rik, A830082D05, AMPKalpha2 Add to Cart
    Cas9-GFP_sg_mTfebsgTfeb (Mus musculus)Mammalian Expression, CRISPR Shaw AMPK governs lineage specification through Tfeb-dependent regulation of lysosomes. Genes Dev. 2016 Mar 1;30(5):535-52. doi: 10.1101/gad.274142.115. Expresses WT Cas9 and GFP, along with a sgRNA to mouse Tfeb. pSpCas9(BB)-2A-GFP (PX458) Tfeb Tcfeb, bHLHe35 Add to Cart
    pcDNA3.1_pCMV-nCas-PmCDA1-ugi pH1-gRNA(HPRT)SpCas9 (Other)Mammalian Expression Kondo Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science. 2016 Aug 4. pii: aaf8729. Expresses nCas9-PmCDA1-UGI and gRNA(HPRT) in mammalian cells pcDNA3.1 Add to Cart
    pcDNA3.1_pCMV-dCas-PmCDA1 pH1-gRNA(HPRT)SpCas9 (Other)Mammalian Expression Kondo Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science. 2016 Aug 4. pii: aaf8729. Expresses dCas9-PmCDA1 and gRNA(HPRT) in mammalian cells pcDNA3.1 Add to Cart
    pX330-sgRNA_Drosha_1sgRNA Drosha (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073. CRISPR/Cas9 DROSHA pX330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    pX330-sgRNA_Drosha_2sgRNA Drosha (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073. CRISPR/Cas9 DROSHA pX330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    pX330-sgRNA_Drosha_3sgRNA Drosha (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073. CRISPR/Cas9 DROSHA pX330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    pX330-sgRNA_Drosha_4sgRNA Drosha (Mus musculus)Mammalian Expression, Bacterial Expression, Mouse Targeting, CRISPR Ciaudo Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017 Jan 18. pii: jcb.201606073. doi: 10.1083/jcb.201606073. CRISPR/Cas9 DROSHA pX330-U6-Chimeric_BB-CBh-hSpCas9 Add to Cart
    pJMP2sgRNA RR1 (Other)Bacterial Expression, CRISPR Gross A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26. Bacillus subtilis sgRNA expression vector; integrates into amyE pDG1662 Add to Cart
    pJMP3sgRNA RR1 (Other)Bacterial Expression, CRISPR Gross A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26. Bacillus subtilis sgRNA expression vector; integrates into thrC pDG1731 Add to Cart
    eSpCas9(1.1)_No_FLAG_AAVS1_T2Mammalian Expression, CRISPR Doyon A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells. Cell Rep. 2015 Oct 7. pii: S2211-1247(15)01020-7. doi: 10.1016/j.celrep.2015.09.009. Expresses the AAVS1 T2 gRNA in combination with FLAGless eSpCas9(1.1) to target the AAVS1 "safe harbor" locus. pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Tag / Fusion Protein
    • Untagged eSpCas9(1.1)
  • Add to Cart
    SP_gRNA_pUC19_N_FancF_LeftFancF_Site_1_Left (Homo sapiens)CRISPR Doyon A Scalable Genome-Editing-Based Approach for Mapping Multiprotein Complexes in Human Cells. Cell Rep. 2015 Oct 7. pii: S2211-1247(15)01020-7. doi: 10.1016/j.celrep.2015.09.009. Human gRNA expression vector targeting FANCF (site 1 left) pUC19 Add to Cart
    pX330-COSMC-KOCOSMC (Homo sapiens)CRISPR Neelamegham Using CRISPR-Cas9 to quantify the contributions of O-glycans, N-glycans and Glycosphingolipids to human leukocyte-endothelium adhesion. Sci Rep. 2016 Jul 26;6:30392. doi: 10.1038/srep30392. gRNA to knock out expression of COSMC (C1GalT1C1) gene. The product of this gene is a chaperone aiding in synthesis of Core1 structures on O-linked glycans. pX330-U6-Chimeric_BB-CBh-hSpCas9 C1GALT1C1 C1GALT2, C38H2-L1, COSMC, HSPC067, MST143, TNPS Add to Cart
    pX330-MGAT1-KOMGAT1 (Homo sapiens)CRISPR Neelamegham Using CRISPR-Cas9 to quantify the contributions of O-glycans, N-glycans and Glycosphingolipids to human leukocyte-endothelium adhesion. Sci Rep. 2016 Jul 26;6:30392. doi: 10.1038/srep30392. gRNA to knock out expression of MGAT1 gene. The product of this gene is essential for synthesis of complex and hybrid N-Glycans. pX330-U6-Chimeric_BB-CBh-hSpCas9 MGAT1 GLCNAC-TI, GLCT1, GLYT1, GNT-1, GNT-I, GnTI, MGAT Add to Cart
    pX330-UGCG-KOUGCG (Homo sapiens)CRISPR Neelamegham Using CRISPR-Cas9 to quantify the contributions of O-glycans, N-glycans and Glycosphingolipids to human leukocyte-endothelium adhesion. Sci Rep. 2016 Jul 26;6:30392. doi: 10.1038/srep30392. gRNA to knock out expression of UGCG gene. The product of this gene catalyzes the first step in synthesis of glycosphingolipids. pX330-U6-Chimeric_BB-CBh-hSpCas9 UGCG GCS, GLCT1 Add to Cart
    pU6-SAG1-DHFRSAG1 sgRNACRISPR Lourido A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2. Encodes a CRISPR sgRNA that allows for mutation of the surface antigen SAG1 in Toxoplasma gondii and confers resistance to pyrimethamine pU6-DHFR Add to Cart
    pU6-DecoyDecoy sgRNACRISPR Lourido A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2. Encodes Cas9 and a CRISPR sgRNA that alleviates toxicity to Cas9 in Toxoplasma gondii pU6-Universal Add to Cart
    pXAT2AAVS1 sgRNA-T2 (Homo sapiens)Mammalian Expression, CRISPR Woltjen Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Methods. 2015 Dec 18. pii: S1046-2023(15)30181-X. doi: 10.1016/j.ymeth.2015.12.012. AAVS1 sgRNA expression vector pX330 Add to Cart
    peSpCas9(1.1)-2×sgRNA (IFT88, donor)IFT88 gRNA#1 (Homo sapiens)Mammalian Expression, CRISPR Nakayama Practical method for targeted disruption of cilia-related genes by using CRISPR/Cas9-mediated homology-independent knock-in system. Mol Biol Cell. 2017 Feb 8. pii: mbc.E17-01-0051. doi: 10.1091/mbc.E17-01-0051. Expresses eSpCas9(1.1) and two sgRNAs. The first gRNA targets human IFT88 and the second gRNA targets a pDonor-tBFP-NLS-Neo (Universal). peSpCas9(1.1)-2×sgRNA (empty, donor) IFT88 D13S1056E, DAF19, TG737, TTC10, hTg737 Add to Cart
    pAAV-SMVP-Cas9N-U6-gRNA M3Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA M3 for Mstn cleavage. pZac2.1 Add to Cart
    pAAV-SMVP-Cas9N-U6-gRNA M4Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA M4 for Mstn cleavage. pZac2.1 Add to Cart
    pAAV-SMVP-Cas9N-U6-gRNA TdLCas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA TdL for Ai9 cleavage. pZac2.1 Add to Cart
    pAAV-SMVP-Cas9N-U6-gRNA TdRCas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA TdR for Ai9 cleavage. pZac2.1 Add to Cart
    pAAV-SMVP-Cas9N-U6-gRNA P1Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA P1 for Pd-l1 binding. pZac2.1 Add to Cart
    pAAV-SMVP-Cas9N-U6-gRNA P2Cas9N (Synthetic)Mammalian Expression, AAV, CRISPR, Synthetic Biology Church A multifunctional AAV-CRISPR-Cas9 and its host response. Nat Methods. 2016 Sep 5. doi: 10.1038/nmeth.3993. Expresses Cas9N in mammalian cells; expresses gRNA P2 for Pd-l1 binding pZac2.1 Add to Cart
    pHu6-gRNA-NT1hU6 expression of gRNA NT1 (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. hU6 expression of gRNA NT1 pHU6 Add to Cart
    pHU6_gRNA_Ch10-rev2hU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. for targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 5' of gix site) pHU6 Add to Cart
    pHU6_gRNA_Ch10-rev1hU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. for targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 5' of gix site) pHU6 Add to Cart
    pHU6_gRNA_Ch10-for2hU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. for targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 3' of gix site) pHU6 Add to Cart
    pHU6_gRNA_Ch10-for1hU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. for targeting Ch10 psuedo gix site in PCDH15 gene(six base pairs from the cas9 site and 3' of gix site) pHU6 Add to Cart
    pHU6_Ch5_155183064-gRNA-forhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch5 reporter pHU6 Add to Cart
    pHU6_Ch5_155183064-gRNA-revhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch5 reporter pHU6 Add to Cart
    pHU6_Ch12_62418577-gRNA-forhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch12 reporter pHU6 Add to Cart
    pHU6_Ch12_62418577-gRNA-revhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch12 reporter pHU6 Add to Cart
    pHU6_Ch13_102010574-gRNA-forhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch13 reporter pHU6 Add to Cart
    pHU6_Ch13_102010574-gRNA-revhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 5' region of pCALNL_Ch13 reporter pHU6 Add to Cart
    pHU6_chr12_FAM19A2-up-gRNA-revhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the upstream region of FAM19A2 locus pHU6 Add to Cart
    pHU6_chr12_FAM19A2-up-gRNA-forhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the upstream region of FAM19A2 locus pHU6 Add to Cart
    pHU6_chr12_FAM19A2-down-gRNA-revhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the downstream region of FAM19A2 locus pHU6 Add to Cart
    pHU6_chr12_FAM19A2-down-gRNA-forhU6 expression of gRNA (Homo sapiens)Mammalian Expression Liu A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. pHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the downstream region of FAM19A2 locus pHU6 Add to Cart
    TU#1805_CRISPR_unc-73_exon2Cas9 and sgRNA against unc-73 exon2 (Caenorhabditis elegans)Worm Expression, CRISPR Chalfie GEFs and Rac GTPases control directional specificity of neurite extension along the anterior-posterior axis. Proc Natl Acad Sci U S A. 2016 Jun 21;113(25):6973-8. doi: 10.1073/pnas.1607179113. Epub 2016 Jun 6. to create unc-73B null allele pDD162 unc-73 CELE_F55C7.7 Add to Cart
    TU#1806_CRISPR_unc-73_exon21Cas9 and sgRNA against unc-73 exon21 (Caenorhabditis elegans)Worm Expression, CRISPR Chalfie GEFs and Rac GTPases control directional specificity of neurite extension along the anterior-posterior axis. Proc Natl Acad Sci U S A. 2016 Jun 21;113(25):6973-8. doi: 10.1073/pnas.1607179113. Epub 2016 Jun 6. to create unc-73E null allele pDD162 unc-73 CELE_F55C7.7 Add to Cart
    pCas5gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP expressed from pJ23119 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas13gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP (truncated to 12 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas14gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP (truncated to 15 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas15gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP (truncated to 18 bp) expressed from pJ23119 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas27gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP expressed from pJ23117 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas28gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP expressed from pJ23108 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas34gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas35gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting cpcB expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas36gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting ccmK expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas39gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting glnA expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas45gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP with additional bases 5' end like pCas34, but from pJ23119 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas52gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP +52 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas55gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP +172 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas56gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP +46 from TSS; template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas57gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP +111 from TSS; template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    pCas59gRNA Pfleger CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab Eng. 2016 Jul 29. pii: S1096-7176(16)30062-3. doi: 10.1016/j.ymben.2016.07.007. sgRNA targeting YFP +787 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistance pUC19 Add to Cart
    T-STOP sgRNA-1T-STOP sgRNA (Homo sapiens)Mammalian Expression Thomson Single-cell RNA-seq reveals novel regulators of human embryonic stem cell differentiation to definitive endoderm. Genome Biol. 2016 Aug 17;17(1):173. doi: 10.1186/s13059-016-1033-x. The sgRNA at the stop codon of human Brachyury(T) locus pCR-Blunt II-TOPO Add to Cart
    pCFD3-ebonyebony (Drosophila melanogaster)Insect Expression, CRISPR Padgett Efficient Screening of CRISPR/Cas9-Induced Events in Drosophila Using a Co-CRISPR Strategy. G3 (Bethesda). 2017 Jan 5;7(1):87-93. doi: 10.1534/g3.116.036723. Drosophila gRNA expression plasmid targets ebony pCFD3 e Dmel_CG3331, CG3331, Dmel\CG3331 Add to Cart
    Sg-ASgRNACRISPR Feng Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. Nucleic Acids Res. 2016 May 19;44(9):e85. doi: 10.1093/nar/gkw064. Epub 2016 Feb 4. Express sgRNA targeting SA site MLM3636 Add to Cart
    sgRNA 2 GAPDHSgRNACRISPR Feng Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair. Nucleic Acids Res. 2016 May 19;44(9):e85. doi: 10.1093/nar/gkw064. Epub 2016 Feb 4. Express Sg-2 sgRNA targeting GAPDH MLM3636 Add to Cart
    pCfB2311 (SNR52p-gRNA.ADE2-SUP4t_natMX)gRNA targeting ADE2 gene (Saccharomyces cerevisiae)Yeast Expression Borodina CRISPR–Cas system enables fast and simple genome editing of industrial Saccharomyces cerevisiae strains Metab Eng Commun 2015 gRNA cassette-carrying vector with natMX marker p426-SNR52p-gRNA.CAN1.Y-SUP4t Add to Cart
    pCFD4d-U6-1:white1-U6-3:white1white sgRNA-1 (Drosophila melanogaster), white sgRNA-1 (Drosophila melanogaster)CRISPR Zamore Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Co-conversion. G3 (Bethesda). 2016 Aug 26. pii: g3.116.032557. doi: 10.1534/g3.116.032557. pCFD4d expresses white sgRNA-1 from a U6:3 promoter and the same white sgRNA-1 from a U6:1 promoter pCFD4d Add to Cart
    pUC57-white[coffee]A 2,080 bp fragment of the white[coffee] allele (Drosophila melanogaster)Unspecified Zamore Rapid Screening for CRISPR-Directed Editing of the Drosophila Genome Using white Co-conversion. G3 (Bethesda). 2016 Aug 26. pii: g3.116.032557. doi: 10.1534/g3.116.032557. Donor HR template carrying a 2,080 bp fragment of the Drosophila melanogaster white[coffee] allele and silent mutations conferring resistance to white sgRNAs-1, -2, -3, and -4 pUC57 w Dmel_CG2759, BACN33B1.1, CG2759, DMWHITE, Dmel\CG2759, EG:BACN33B1.1, Hid, W, c23, e(g), m(g), mw, w(AT)[[13]] Add to Cart
    pSLQ1870-1 pHR: U6-SpsgTRE3G CMV-mCherrySp sgTRE3G (Synthetic)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses Sp sgTRE3G gRNA with a mCherry fluorescent marker pHR Add to Cart
    pSLQ1869-1 pHR: U6-SpsgSV40 CMV-mCherrySp sgSV40 (Synthetic)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses Sp sgSV40 gRNA with a mCherry fluorescent marker pHR Add to Cart
    pSLQ2806-2 pHR: U6-Sasgv2TRE3G CMV-mCherrySa sgTRE3G (Synthetic)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses optimized Sa sgTRE3G gRNA with a mCherry fluorescent marker pHR Add to Cart
    pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFPSp sgCD95-1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses Sp sgCD95-1 gRNA with an EGFP fluorescent marker pHR Add to Cart
    pSLQ1852-3 pHR: U6-SpsgCD95-2 CMV-EGFPSp sgCD95-2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses Sp sgCD95-2 gRNA with an EGFP fluorescent marker pHR Add to Cart
    pSLQ1852-5 pHR: U6-SpsgCD95-3 CMV-EGFPSp sgCD95-3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses Sp sgCD95-3 gRNA with an EGFP fluorescent marker pHR Add to Cart
    pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFPSa sgCXCR4-1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses optimized Sa sgCXCR4-1 gRNA with an EGFP fluorescent marker pHR Add to Cart
    pSLQ2853-4 pHR: U6-Sasgv2CXCR4-2 CMV-EGFPSa sgCXCR4-2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses optimized Sa sgCXCR4-2 gRNA with an EGFP fluorescent marker pHR Add to Cart
    pSLQ2853-5 pHR: U6-Sasgv2CXCR4-3 CMV-EGFPSa sgCXCR4-3 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses optimized Sa sgCXCR4-3 gRNA with an EGFP fluorescent marker pHR Add to Cart
    pSLQ2804 pHR: U6-SpsgTRE3G CMV-PYL1-VPR-IRES-mCherrySp sgTRE3G (Synthetic), PYL1-VPR (Arabidopsis thaliana)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses Sp sgTRE3G gRNA with ABA-inducible VPR and mCherry for OR gate pHR Add to Cart
    pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherrySp sgSV40 (Synthetic), PYL1-KRAB (Arabidopsis thaliana)Mammalian Expression, Lentiviral, CRISPR Qi Complex transcriptional modulation with orthogonal and inducible dCas9 regulators. Nat Methods. 2016 Oct 24. doi: 10.1038/nmeth.4042. Expresses Sp sgSV40 gRNA with ABA-inducible KRAB and mCherry for diametric regulation pHR Add to Cart
    pSPneogRNA241510+MTLdBPK_241510.1 targeting gRNA and LdMT targeting gRNA (Other)CRISPR ; Leishmania donovani Matlashewski Optimized CRISPR-Cas9 Genome Editing for Leishmania and Its Use To Target a Multigene Family, Induce Chromosomal Translocation, and Study DNA Break Repair Mechanisms. mSphere. 2017 Jan 18;2(1). pii: e00340-16. doi: 10.1128/mSphere.00340-16. eCollection 2017 Jan-Feb. Express LdPBK_241510.1 and LdMT targeting gRNAs simutaneously pSP72 Add to Cart
    mCBFKOgRNA2Cbfa2t2-gRNA2 (Mus musculus)Mammalian Expression, CRISPR Reinberg Co-repressor CBFA2T2 regulates pluripotency and germline development. Nature. 2016 Jun 8;534(7607):387-90. doi: 10.1038/nature18004. Cas9-gRNA plasmid for mouse Cbfa2t2 Knockout pSpCas9(BB)-2A-GFP Add to Cart
    mCBFKOgRNA5Cbfa2t2-gRNA5 (Mus musculus)Mammalian Expression, CRISPR Reinberg Co-repressor CBFA2T2 regulates pluripotency and germline development. Nature. 2016 Jun 8;534(7607):387-90. doi: 10.1038/nature18004. Cas9-gRNA plasmid for mouse Cbfa2t2 Knockout pSpCas9(BB)-2A-GFP Add to Cart
    mCm7RNA6ACbfa2t2 m7-gRNA6 (Mus musculus)Mammalian Expression, CRISPR Reinberg Co-repressor CBFA2T2 regulates pluripotency and germline development. Nature. 2016 Jun 8;534(7607):387-90. doi: 10.1038/nature18004. Cas9-gRNA plasmid for mouse Cbfa2t2 m7 mutant knockin pSpCas9(BB)-2A-GFP Add to Cart
    gRNA-mCtnnb1mCtnnb1 gRNA (Synthetic)CRISPR Koo One-step generation of conditional and reversible gene knockouts. Nat Methods. 2017 Jan 30. doi: 10.1038/nmeth.4156. mCtnnb1 gRNA expressing vector pCR-Blunt II-TOPO Add to Cart
    pCRISPRyl_AXPCas9Yeast Expression, CRISPR, Synthetic Biology Wheeldon Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19. Introduces DSB at AXP locus in Y. lipolytica pUC19 Add to Cart
    pCRISPRyl_XPR2Cas9Yeast Expression, CRISPR, Synthetic Biology Wheeldon Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19. Introduces DSB at XPR2 locus in Y. lipolytica pUC19 Add to Cart
    pCRISPRyl_A08Cas9Yeast Expression, CRISPR, Synthetic Biology Wheeldon Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19. Introduces DSB at A08 locus in Y. lipolytica pUC19 Add to Cart
    pCRISPRyl_D17Cas9Yeast Expression, CRISPR, Synthetic Biology Wheeldon Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19. Introduces DSB at D17 locus in Y. lipolytica pUC19 Add to Cart
    pCRISPRyl_MFE1Cas9Yeast Expression, CRISPR, Synthetic Biology Wheeldon Standardized markerless gene integration for pathway engineering in Yarrowia lipolytica. ACS Synth Biol. 2016 Dec 19. Introduces DSB at MFE1 locus in Y. lipolytica pUC19 Add to Cart
    LCV2 V-1gRNA targeting VEGF-A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Yiu Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296. Cas9 with sgRNA targeting Exon 1 of VEGF-A LentiCRISPRv2 VEGFA MVCD1, VEGF, VPF Add to Cart
    LCV2 V-2gRNA targeting VEGF-A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Yiu Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296. Cas9 with sgRNA targeting Exon 1 of VEGF-A LentiCRISPRv2 VEGFA MVCD1, VEGF, VPF Add to Cart
    LCV2 V-3gRNA targeting VEGF-A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Yiu Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296. Cas9 with sgRNA targeting Exon 1 of VEGF-A LentiCRISPRv2 VEGFA MVCD1, VEGF, VPF Add to Cart
    LCV2 V-4gRNA targeting VEGF-A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Yiu Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296. Cas9 with sgRNA targeting Exon 1 of VEGF-A LentiCRISPRv2 VEGFA MVCD1, VEGF, VPF Add to Cart
    LCV2 V-5gRNA targeting VEGF-A (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Yiu Genomic Disruption of VEGF-A Expression in Human Retinal Pigment Epithelial Cells Using CRISPR-Cas9 Endonuclease. Invest Ophthalmol Vis Sci. 2016 Oct 1;57(13):5490-5497. doi: 10.1167/iovs.16-20296. Cas9 with sgRNA targeting Exon 1 of VEGF-A LentiCRISPRv2 VEGFA MVCD1, VEGF, VPF Add to Cart
    FgH1tUTG_huMcl-1.1hu Mcl-1.1 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26. Inducible expression of guide RNA (huMcl-1.1) with fluorescent GFP reporter FUGW MCL1 BCL2L3, EAT, MCL1-ES, MCL1L, MCL1S, Mcl-1, TM, bcl2-L-3, mcl1/EAT Add to Cart
    FgH1tUTG_huMcl-1.2hu Mcl-1.2 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26. Inducible expression of guide RNA (huMcl-1.2) with fluorescent GFP reporter FUGW Add to Cart
    FgH1tUTG_huBim_Ex3hu Bim (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26. Inducible expression of guide RNA (huBim_Ex3) with fluorescent GFP reporter FUGW Add to Cart
    FgH1tUTG_muBim_Ex3mu Bim (Mus musculus) Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26. Inducible expression of guide RNA (muBim_Ex3) with fluorescent GFP reporter FUGW Add to Cart
    FgH1tUTG_mup53_Ex4mu p53 (Mus musculus) Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26. Inducible expression of guide RNA (mup53_Ex4) with fluorescent GFP reporter FUGW Add to Cart
    FgH1tUTG_mup53_Ex5mu p53 (Mus musculus)Mammalian Expression, Lentiviral, CRISPR Herold An inducible lentiviral guide RNA platform enables the identification of tumor-essential genes and tumor-promoting mutations in vivo. Cell Rep. 2015 Mar 3;10(8):1422-32. doi: 10.1016/j.celrep.2015.02.002. Epub 2015 Feb 26. Inducible expression of guide RNA (mup53_Ex5) with fluorescent GFP reporter FUGW Add to Cart
    sgAPC(A)APC, WNT signaling pathway regulator (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human APC around codon I1417 pSpCas9(BB)-2A-Puro (PX459) APC BTPS2, DP2, DP2.5, DP3, GS, PPP1R46 Add to Cart
    sgAPC(B)APC, WNT signaling pathway regulator (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human APC around codon I1417 pSpCas9(BB)-2A-Puro (PX459) APC BTPS2, DP2, DP2.5, DP3, GS, PPP1R46 Add to Cart
    sgTP53(A)tumor protein p53 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human TP53 around codon F109 pSpCas9(BB)-2A-Puro (PX459) TP53 BCC7, LFS1, P53, TRP53 Add to Cart
    sgTP53(B)tumor protein p53 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human TP53 around codon F109 pSpCas9(BB)-2A-Puro (PX459) TP53 BCC7, LFS1, P53, TRP53 Add to Cart
    sgTP53(R273)tumor protein p53 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human TP53 around codon R273 pSpCas9(BB)-2A-Puro (PX459) TP53 BCC7, LFS1, P53, TRP53 Add to Cart
    sgALK(A)anaplastic lymphoma receptor tyrosine kinase (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human ALK around codon F1174 pSpCas9(BB)-2A-Puro (PX459) ALK CD246, NBLST3 Add to Cart
    sgALK(B)anaplastic lymphoma receptor tyrosine kinase (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human ALK around codon F1174 pSpCas9(BB)-2A-Puro (PX459) ALK CD246, NBLST3 Add to Cart
    sgEGFR(A)epidermal growth factor receptor (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human EGFR around codon T790 pSpCas9(BB)-2A-Puro (PX459) EGFR ERBB, ERBB1, HER1, NISBD2, PIG61, mENA Add to Cart
    sgEGFR(B)epidermal growth factor receptor (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human EGFR around codon T790 pSpCas9(BB)-2A-Puro (PX459) EGFR ERBB, ERBB1, HER1, NISBD2, PIG61, mENA Add to Cart
    sgKRAS(A)KRAS proto-oncogene, GTPase (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human KRAS around codon G12 pSpCas9(BB)-2A-Puro (PX459) KRAS C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RALD, RASK2, c-Ki-ras2 Add to Cart
    sgKRAS(B)KRAS proto-oncogene, GTPase (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human KRAS around codon G12 pSpCas9(BB)-2A-Puro (PX459) KRAS C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, KI-RAS, KRAS1, KRAS2, NS, NS3, RALD, RASK2, c-Ki-ras2 Add to Cart
    sgEML4echinoderm microtubule associated protein like 4 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human EML4 between exon 13 and 14 pSpCas9(BB)-2A-Puro (PX459) EML4 C2orf2, ELP120, EMAP-4, EMAPL4, ROPP120 Add to Cart
    sgALK(Chr. Inv.)anaplastic lymphoma receptor tyrosine kinase (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human ALK between exon 20 and 21 pSpCas9(BB)-2A-Puro (PX459) ALK CD246, NBLST3 Add to Cart
    sgAAVS1(A)adeno-associated virus integration site 1 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human AAVS1 locus pSpCas9(BB)-2A-Puro (PX459) AAVS1 AAV Add to Cart
    sgAAVS1(B)adeno-associated virus integration site 1 (Homo sapiens)Mammalian Expression Grumolato CRISPR-Barcoding for Intratumor Genetic Heterogeneity Modeling and Functional Analysis of Oncogenic Driver Mutations. Mol Cell. 2016 Aug 4;63(3):526-38. doi: 10.1016/j.molcel.2016.06.017. Epub 2016 Jul 21. Expresses sgRNA targeting human AAVS1 locus pSpCas9(BB)-2A-Puro (PX459) AAVS1 AAV Add to Cart
    pAW014-2ugtP-gRNA.P395TBacterial Expression Chou Development of a CRISPR-Cas9 toolkit for comprehensive engineering of Bacillus subtilis. Appl Environ Microbiol. 2016 Jun 3. pii: AEM.01159-16. Multi-gRNA delivery vector containing ugtP-gRNA.P395T for Bacillus subtilis modified pIEFBPR (ColE1) Add to Cart
    pAGM4723:TpCC_UreaseCas9 (Other), Urease-targeting gRNA 1 (Other), Urease-targeting gRNA 2 (Other)CRISPR ; Diatom (T. pseudonana) Mock Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana Plant Methods 2016, 12:49 Golden Gate Level 2 construct encoding Cas9-YFP and 2 urease-targeting gRNAs pAGM4723 Add to Cart
    AAT_g1 gRNApU6-AAT_g1 sgRNA (Other)Mammalian Expression, CRISPR Cantz Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198. plasmid vector encoding for U6-driven AAT_g1 gRNA pEX-A Add to Cart
    AAT_g2 gRNApU6-AAT_g2 sgRNA (Other)Mammalian Expression, CRISPR Cantz Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198. plasmid vector encoding for U6-driven AAT_g2 gRNA (Z-allele specific) pCR2.1 Add to Cart
    Lenti CGIP + Z-AAT targetCAG promoter (Other), Z-AAT target (Homo sapiens)Lentiviral Cantz Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198. lenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864 unknown Add to Cart
    Lenti CGIP + M-AAT targetCAG promoter (Other), M-AAT target (Homo sapiens)Lentiviral Cantz Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198. lenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864 unknown Add to Cart
    Lenti CGIP + TTR targetCAG promoter (Other), TTR target (Homo sapiens)Lentiviral Cantz Improved bi-allelic modification of a transcriptionally silent locus in patient-derived iPSC by Cas9 nickase. Sci Rep. 2016 Dec 2;6:38198. doi: 10.1038/srep38198. lenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864 unknown Add to Cart
    LentiCRISPR-sgPREX1gRNA targeting PREX1Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9 and an sgRNA targeting PREX1 pLentiCRISPR v1 PREX1 P-REX1 Add to Cart
    LentiCRISPR-sgSHOC2-1sgRNA 1 targeting SHOC2Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9 and an sgRNA targeting SHOC2 pLentiCRISPR v1 SHOC2 SIAA0862, SOC2, SUR8 Add to Cart
    LentiCRISPR-sgSHOC2-2sgRNA 2 targeting SHOC2Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9 and an sgRNA targeting SHOC2 pLentiCRISPR v1 SHOC2 SIAA0862, SOC2, SUR8 Add to Cart
    LentiCRISPR-sgC1orf27-1sgRNA 1 targeting C1orf27 (Homo sapiens)Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9 and an sgRNA targeting C1orf27 pLentiCRISPR v1 C1orf27 ODR4, TTG1, odr-4 Add to Cart
    LentiCRISPR-sgC1orf27-2sgRNA 2 targeting C1orf27Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9 and an sgRNA targeting C1orf27 pLentiCRISPR v1 C1orf27 ODR4, TTG1, odr-4 Add to Cart
    LentiCRISPR-sgUBA5sgRNA targeting UBA5Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9 and an sgRNA targeting UBA5 pLentiCRISPR v1 UBA5 EIEE44, SCAR24, THIFP1, UBE1DC1 Add to Cart
    LentiCRISPR-sgUFM1sgRNA targeting UFM1Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9 and an sgRNA targeting UFM1 pLentiCRISPR v1 UFM1 BM-002, C13orf20 Add to Cart
    LentiCRISPR-sgUFSP2sgRNA targeting UFSP2Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9 and an sgRNA targeting UFSP2 pLentiCRISPR v1 UFSP2 BHD, C4orf20 Add to Cart
    LentiCRISPR-sgC17orf89-2sgRNA targeting C17orf89Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9 and an sgRNA targeting C17orf89 pLentiCRISPR v1 NDUFAF8 C17orf89 Add to Cart
    LentiCRISPR-sgC17orf89-3sgRNA 3 targeting C17orf89Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9 and an sgRNA targeting C17orf89 pLentiCRISPR v1 NDUFAF8 C17orf89 Add to Cart
    LentiCRISPR-sgC17orf89-1sgRNA 1 targeting C17orf89Mammalian Expression, Lentiviral, CRISPR Sabatini Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. Lentiviral vector expressing Cas9 and an sgRNA targeting C17orf89 pLentiCRISPR v1 NDUFAF8 C17orf89 Add to Cart
    PX458_KDM1A_1gRNA against KDM1A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human KDM1A PX458 KDM1A AOF2, BHC110, CPRF, KDM1, LSD1 Add to Cart
    PX458_KDM1A_2gRNA against KDM1A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human KDM1A PX458 KDM1A AOF2, BHC110, CPRF, KDM1, LSD1 Add to Cart
    PX458_FOXP1_1gRNA against FOXP1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human FOXP1 PX458 FOXP1 12CC4, HSPC215, MFH, QRF1, hFKH1B Add to Cart
    PX458_FOXP1_2gRNA against FOXP1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human FOXP1 PX458 FOXP1 12CC4, HSPC215, MFH, QRF1, hFKH1B Add to Cart
    PX458_HLF_1gRNA against HLF (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human HLF PX458 HLF MGC33822 Add to Cart
    PX458_HLF_2gRNA against HLF (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human HLF PX458 HLF MGC33822 Add to Cart
    PX458_MBD1_iso1_2gRNA against MBD1_iso1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human MBD1_iso1 PX458 MBD1 CXXC3, PCM1, RFT Add to Cart
    PX458_ZNF644_1gRNA against ZNF644 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZNF644 PX458 ZNF644 BM-005, MYP21, NatF, ZEP-2 Add to Cart
    PX458_ZNF644_2gRNA against ZNF644 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZNF644 PX458 ZNF644 BM-005, MYP21, NatF, ZEP-2 Add to Cart
    PX458_KDM6A_1gRNA against KDM6A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human KDM6A PX458 KDM6A KABUK2, UTX, bA386N14.2 Add to Cart
    PX458_KDM6A_2gRNA against KDM6A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human KDM6A PX458 KDM6A KABUK2, UTX, bA386N14.2 Add to Cart
    PX458_KAT7_1gRNA against KAT7 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human KAT7 PX458 KAT7 HBO1, HBOA, MYST2, ZC2HC7 Add to Cart
    PX458_SAP130_1gRNA against SAP130 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human SAP130 PX458 SAP130 Add to Cart
    PX458_SAP130_2gRNA against SAP130 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human SAP130 PX458 SAP130 Add to Cart
    PX458_ZSCAN9_1gRNA against ZSCAN9 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZSCAN9 PX458 ZNF193 PRD51, ZSCAN9 Add to Cart
    PX458_ZSCAN9_2gRNA against ZSCAN9 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZSCAN9 PX458 ZNF193 PRD51, ZSCAN9 Add to Cart
    PX458_KLF11_1gRNA against KLF11 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human KLF11 PX458 KLF11 FKLF, FKLF1, MODY7, TIEG2, Tieg3 Add to Cart
    PX458_KLF11_2gRNA against KLF11 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human KLF11 PX458 KLF11 FKLF, FKLF1, MODY7, TIEG2, Tieg3 Add to Cart
    PX458_ZNF652_1gRNA against ZNF652 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZNF652 PX458 ZNF652 Add to Cart
    PX458_ZNF652_2gRNA against ZNF652 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZNF652 PX458 ZNF652 Add to Cart
    PX458_HMG20A_1gRNA against HMG20A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human HMG20A PX458 HMG20A HMGX1, HMGXB1 Add to Cart
    PX458_HMG20A_2gRNA against HMG20A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human HMG20A PX458 HMG20A HMGX1, HMGXB1 Add to Cart
    PX458_HBP1_1gRNA against HBP1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human HBP1 PX458 HBP1 Add to Cart
    PX458_KDM3A_1gRNA against KDM3A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human KDM3A PX458 KDM3A JHDM2A, JHMD2A, JMJD1, JMJD1A, TSGA Add to Cart
    PX458_KDM3A_2gRNA against KDM3A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human KDM3A PX458 KDM3A JHDM2A, JHMD2A, JMJD1, JMJD1A, TSGA Add to Cart
    PX458_MIER3_1gRNA against MIER3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human MIER3 PX458 MIER3 FLJ35954, DKFZp781G1119, DKFZp781I1119, DKFZp686L09111 Add to Cart
    PX458_MIER3_2gRNA against MIER3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human MIER3 PX458 MIER3 FLJ35954, DKFZp781G1119, DKFZp781I1119, DKFZp686L09111 Add to Cart
    PX458_TFE3_1gRNA against TFE3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human TFE3 PX458 TFE3 RCCP2, RCCX1, TFEA, bHLHe33 Add to Cart
    PX458_TFE3_2gRNA against TFE3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human TFE3 PX458 TFE3 RCCP2, RCCX1, TFEA, bHLHe33 Add to Cart
    PX458_ZGPAT_1gRNA against ZGPAT (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZGPAT PX458 ZGPAT ZIP, ZC3H9, GPATC6, GPATCH6, ZC3HDC9, KIAA1847, MGC44880, RP4-583P15.3 Add to Cart
    PX458_ZGPAT_2gRNA against ZGPAT (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZGPAT PX458 ZGPAT ZIP, ZC3H9, GPATC6, GPATCH6, ZC3HDC9, KIAA1847, MGC44880, RP4-583P15.3 Add to Cart
    PX458_MLX_1gRNA against MLX (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human MLX PX458 MLX MAD7, MXD7, TCFL4, bHLHd13 Add to Cart
    PX458_MLX_2gRNA against MLX (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human MLX PX458 MLX MAD7, MXD7, TCFL4, bHLHd13 Add to Cart
    PX458_ZNF580_1gRNA against ZNF580 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZNF580 PX458 ZNF580 Add to Cart
    PX458_ZNF580_2gRNA against ZNF580 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZNF580 PX458 ZNF580 Add to Cart
    PX458_GATAD2A_1gRNA against GATAD2A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human GATAD2A PX458 GATAD2A p66alpha Add to Cart
    PX458_GATAD2A_2gRNA against GATAD2A (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human GATAD2A PX458 GATAD2A p66alpha Add to Cart
    PX458_MIXL1_1gRNA against MIXL1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human MIXL1 PX458 MIXL1 MILD1, MIX, MIXL Add to Cart
    PX458_MIXL1_2gRNA against MIXL1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human MIXL1 PX458 MIXL1 MILD1, MIX, MIXL Add to Cart
    PX458_TEAD3_1gRNA against TEAD3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human TEAD3 PX458 TEAD3 DTEF-1, ETFR-1, TEAD-3, TEAD5, TEF-5, TEF5 Add to Cart
    PX458_TEAD3_2gRNA against TEAD3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human TEAD3 PX458 TEAD3 DTEF-1, ETFR-1, TEAD-3, TEAD5, TEF-5, TEF5 Add to Cart
    PX458_ZNF792_1gRNA against ZNF792 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZNF792 PX458 ZNF792 FLJ38451, MGC117233, MGC119731 Add to Cart
    PX458_ZNF792_2gRNA against ZNF792 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZNF792 PX458 ZNF792 FLJ38451, MGC117233, MGC119731 Add to Cart
    PX458_NCoA2_1gRNA against NCoA2 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human NCoA2 PX458 NCOA2 GRIP1, KAT13C, NCoA-2, SRC2, TIF2, bHLHe75 Add to Cart
    PX458_NR2F6_1gRNA against NR2F6 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human NR2F6 PX458 NR2F6 EAR-2, EAR2, ERBAL2 Add to Cart
    PX458_NR2F6_2gRNA against NR2F6 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human NR2F6 PX458 NR2F6 EAR-2, EAR2, ERBAL2 Add to Cart
    PX458_CEBPG_1gRNA against CEBPG (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human CEBPG PX458 CEBPG GPE1BP, IG/EBP-1 Add to Cart
    PX458_CEBPG_2gRNA against CEBPG (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human CEBPG PX458 CEBPG GPE1BP, IG/EBP-1 Add to Cart
    PX458_KLF9_1gRNA against KLF9 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human KLF9 PX458 KLF9 BTEB, BTEB1 Add to Cart
    PX458_KLF9_2gRNA against KLF9 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human KLF9 PX458 KLF9 BTEB, BTEB1 Add to Cart
    PX458_NFIL3_1gRNA against NFIL3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human NFIL3 PX458 NFIL3 E4BP4, IL3BP1, NF-IL3A, NFIL3A Add to Cart
    PX458_NFIL3_2gRNA against NFIL3 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human NFIL3 PX458 NFIL3 E4BP4, IL3BP1, NF-IL3A, NFIL3A Add to Cart
    PX458_ARID5B_1gRNA against ARID5B (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ARID5B PX458 ARID5B MRF2, DESRT, FLJ21150, RP11-341A19.1 Add to Cart
    PX458_ARID5B_2gRNA against ARID5B (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ARID5B PX458 ARID5B MRF2, DESRT, FLJ21150, RP11-341A19.1 Add to Cart
    PX458_HOMEZ_1gRNA against HOMEZ (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human HOMEZ PX458 HOMEZ KIAA1443 Add to Cart
    PX458_HOMEZ_2gRNA against HOMEZ (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human HOMEZ PX458 HOMEZ KIAA1443 Add to Cart
    PX458_DMAP1_1gRNA against DMAP1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human DMAP1 PX458 DMAP1 DNMAP1, DNMTAP1, EAF2, MEAF2, SWC4 Add to Cart
    PX458_DMAP1_2gRNA against DMAP1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human DMAP1 PX458 DMAP1 DNMAP1, DNMTAP1, EAF2, MEAF2, SWC4 Add to Cart
    PX458_TEAD1_1gRNA against TEAD1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human TEAD1 PX458 TEAD1 AA, NTEF-1, REF1, TCF-13, TCF13, TEAD-1, TEF-1 Add to Cart
    PX458_SOX5_1gRNA against SOX5 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human SOX5 PX458 SOX5 L-SOX5, L-SOX5B, L-SOX5F, LAMSHF Add to Cart
    PX458_CEBPA_1gRNA against CEBPA (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human CEBPA PX458 CEBPA C/EBP-alpha, CEBP Add to Cart
    PX458_CEBPA_2gRNA against CEBPA (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human CEBPA PX458 CEBPA C/EBP-alpha, CEBP Add to Cart
    PX458_ZFP1_iso1_1gRNA against ZFP1_iso1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZFP1_iso1 PX458 ZFP1 ZNF475 Add to Cart
    PX458_ZFP1_iso1_2gRNA against ZFP1_iso1 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human ZFP1_iso1 PX458 ZFP1 ZNF475 Add to Cart
    PX458_SP5_1gRNA against SP5 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human SP5 PX458 Add to Cart
    PX458_SP5_2gRNA against SP5 (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human SP5 PX458 Add to Cart
    PX458_RFXANK_1gRNA against RFXANK (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human RFXANK PX458 RFXANK ANKRA1, BLS, F14150_1, RFX-B Add to Cart
    PX458_RFXANK_2gRNA against RFXANK (Homo sapiens)CRISPR Mendenhall CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Genome Res. 2015 Sep 9. Encodes gRNA for 3' target of human RFXANK PX458 RFXANK ANKRA1, BLS, F14150_1, RFX-B Add to Cart
    pU6-gRNA-TAZU6-gRNA-TAZ (Homo sapiens)CRISPR Pu Efficient, footprint-free human iPSC genome editing by consolidation of Cas9/CRISPR and piggyBac technologies. Nat Protoc. 2017 Jan;12(1):88-103. doi: 10.1038/nprot.2016.152. Epub 2016 Dec 8. Expresses a gRNA targeted to human TAZ pCR-Blunt-II Add to Cart
    HUWE1-sgRNA-1HUWE1 sgRNA1 (Homo sapiens)Mammalian Expression Ye The HECT domain ubiquitin ligase HUWE1 targets unassembled soluble proteins for degradation. Cell Discov. 2016 Nov 8;2:16040. eCollection 2016. To express sgRNA target HUWE1 gene pX330-U6-Chimeric_BB-CBh-hSpCas9(D10A) Add to Cart
    HUWE1-sgRNA-2HUWE1 sgRNA2 (Homo sapiens)Mammalian Expression Ye The HECT domain ubiquitin ligase HUWE1 targets unassembled soluble proteins for degradation. Cell Discov. 2016 Nov 8;2:16040. eCollection 2016. To express sgRNA target HUWE1 gene pX330-U6-Chimeric_BB-CBh-hSpCas9(D10A) Add to Cart
    pJB172gRNA targeting pil1 (Schizosaccharomyces pombe)Yeast Expression Berro Use of a fluoride channel as a new selection marker for fission yeast plasmids and application to fast genome editing with CRISPR/Cas9. Yeast. 2016 Oct;33(10):549-557. doi: 10.1002/yea.3178. Epub 2016 Sep 7. CRISPR/Cas9 in fission yeast using fluoride selection and targetting pil1 pJB166 Add to Cart
    Tubb3gRNA-mCherryMouse Tubb3 gRNA (Synthetic)CRISPR Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. mouse Tubb3 target gRNA expression plasmid with CAGmCherry pCAGmCherry-gRNA Add to Cart
    pAAV-mTubb3U6-mTubb3sgRNA-GFP-EF1a-mCherryKASH-hGHpA (Synthetic)AAV, CRISPR Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. AAV backbone plasmid including GFP knock-in donor and Tubb3gRNA for HITI PX551 Add to Cart
    pAAV-Ai14-HITIU6-Ai14sgRNA-GFPNLS-EF1a-mCherryKASH-pA (Synthetic)AAV, CRISPR Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. AAV backbone plasmid including GFPNLS-pA knock-in donor and Ai14gRNA for HITI PX551 Add to Cart
    pAAV-Ai14-lucU6-Ai14sgRNA-Luciferase-nEF-GFPKASH-hGHpA (Synthetic)AAV, CRISPR, Luciferase Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. AAV backbone plasmid including luc-pA knock-in donor and Ai14gRNA for HITI PX551 Add to Cart
    pAAV-rMERTK-HITIU6-rMertksgRNA-Mertk(intron1-2)-nEF-GFPKASH-pA (Synthetic)AAV, CRISPR Belmonte In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. Gene correction donor AAV for RCS rat. AAV backbone plasmid including exon 2 of rat Mertk and rMertkgRNA for HITI PX551 Add to Cart
    lenti-Cas9-VQR-GFP_activity_reporterGFP and sgRNA targeting GFP (NGA restricted)Lentiviral Bauer Variant-aware saturating mutagenesis using multiple Cas9 nucleases identifies regulatory elements at trait-associated loci. Nat Genet. 2017 Feb 20. doi: 10.1038/ng.3793. This lentiviral vector can be used to assay activity of SpCas9-VQR (NGA PAM restricted). pXPR_011 Add to Cart
    pCDNA-H1-sgRNA-hTZAPTZAP (Homo sapiens)Mammalian Expression, CRISPR Denchi TZAP: A telomere-associated protein involved in telomere length control. Science. 2017 Jan 12. pii: aah6752. doi: 10.1126/science.aah6752. guideRNA targeting exon1 of human TZAP pCDNA-H1-sgRNA ZBTB48 RP11-58A11.4, HKR3, ZNF855, pp9964 Add to Cart
    pCDNA-H1-sgRNA-mTZAPTZAP (Mus musculus)Mammalian Expression, CRISPR Denchi TZAP: A telomere-associated protein involved in telomere length control. Science. 2017 Jan 12. pii: aah6752. doi: 10.1126/science.aah6752. guideRNA targeting exon2 of mouse TZAP pCDNA-H1-sgRNA Zbtb48 RP23-445E20.3, 0610011D15Rik, AI327031, Hkr3 Add to Cart
    p426_Cas9_gRNA-ARS106aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS106a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1. p426 Add to Cart
    p426_Cas9_gRNA-ARS208aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2. p426 Add to Cart
    p426_Cas9_gRNA-ARS308aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3 p426 Add to Cart
    p426_Cas9_gRNA-RDS1aHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3 p426 Add to Cart
    p426_Cas9_gRNA-ARS416dHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4. p426 Add to Cart
    p426_Cas9_gRNA-ARS511bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5. p426 Add to Cart
    p426_Cas9_gRNA-ARS607c Human Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6. p426 Add to Cart
    p426_Cas9_gRNA-SAP155bHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6 p426 Add to Cart
    p426_Cas9_gRNA-SAP155c Human Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6 p426 Add to Cart
    p426_Cas9_gRNA-CAN1yHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6. p426 Add to Cart
    p426_Cas9_gRNA-ARS720aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS720a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7. p426 Add to Cart
    p426_Cas9_gRNA-ARS805aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8. p426 Add to Cart
    p426_Cas9_gRNA-ARS911bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9. p426 Add to Cart
    p426_Cas9_gRNA-ARS1021bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1021b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10. p426 Add to Cart
    p426_Cas9_gRNA-ARS1014aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10. p426 Add to Cart
    p426_Cas9_gRNA-ARS1114aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11. p426 Add to Cart
    p426_Cas9_gRNA-ARS1206aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12. p426 Add to Cart
    p426_Cas9_gRNA-ARS1309aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13. p426 Add to Cart
    p426_Cas9_gRNA-ARS1414aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14. p426 Add to Cart
    p426_Cas9_gRNA-YOLCd1bHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15. p426 Add to Cart
    p426_Cas9_gRNA-HIS3bHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15. p426 Add to Cart
    p426_Cas9_gRNA-ARS1622bHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16. p426 Add to Cart
    p426_Cas9_gRNA-YPRCd15cHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14. p426 Add to Cart
    p426_Cas9_gRNA-R-RDS1aHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. p426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3. p426 Add to Cart
    p425_Cas9_gRNA_LEU_1014aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. p425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10. p425 Add to Cart
    p426_Cas9_gRNA-R-ARS805aHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8. p426 Add to Cart
    p426_Cas9_gRNA-R-ARS607cHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c (Saccharomyces cerevisiae)CRISPR Mukhopadhyay A Cas9-based toolkit to program gene expression in Saccharomyces cerevisiae. Nucleic Acids Res. 2017 Jan 9;45(1):496-508. doi: 10.1093/nar/gkw1023. Epub 2016 Nov 28. p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6. p426 Add to Cart
    pTX198OsPDS-gRNA01 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 pTX172
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • Add to Cart
    pTX199OsPDS-gRNA02 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA02 pTX172
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • Add to Cart
    pTX200OsYSA-gRNA01 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 pTX172
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • Add to Cart
    pTX201OsYSA-gRNA02 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA02 pTX172
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • Add to Cart
    pTX202OsDEP1-gRNA01 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsDEP1 gene, OsDEP1-gRNA01 pTX172
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • Add to Cart
    pTX203OsDEP1-gRNA02 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsDEP1 gene, OsDEP1-gRNA02 pTX172
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • Add to Cart
    pTX208OsYSA-gRNA01 and OsYSA-gRNA02 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsYSA gene, OsYSA-gRNA01 and OsYSA-gRNA02 pTX172
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • Add to Cart
    pTX209OsPDS-gRNA01 and OsPDS-gRNA02 (Other)Plant Expression, CRISPR Voytas A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol Plant. 2016 Jul 6;9(7):1088-91. doi: 10.1016/j.molp.2016.05.001. Epub 2016 May 19. Express STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02 pTX172
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)
  • Add to Cart