We narrowed to 14,414 results for: cas9
-
Plasmid#102933PurposeExpression construct for dCas9 fused to GFP-binding Protein (N-terminally) and mRFP (C-terminus)DepositorInsertdCas9
UseCRISPRTagsGBP (GFP binding protein) and mRFPExpressionMammalianAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cas9/CD4-TK2
Plasmid#104397PurposeThe designed sgRNA cloned into this plasmid directs the specific DNA cleavage exerted by Cas9 nuclease in a region of exon 5 of the human TK2 gene. The plasmid also includes the Cas9 nuclease and CD4.DepositorAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXGFPC-5 Pxyl-dcas9 (Spy)
Plasmid#133316Purposeexpresses dcas9 from Streptococcus pyogenes; repressed with 0.2% glucose, induced with 0.3% xylose; for homologous recombination at the xylose locus in Caulobacter crescentus; tetracycline resistanceDepositorInsertdcas9 (Streptococcus pyogenes)
UseCRISPRPromoterxyloseAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
SIN-PGK-Cas9-V5-WPRE
Plasmid#87876PurposeTo produce lentiviral vector for Cas9 editingDepositorInsertspCas9
UseLentiviralTagsV5MutationHuman codon-optimizedPromotermouse PGKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX406 Pasteurella multocida Cas9
Plasmid#68703PurposePasteurella multocida Cas9DepositorInsertPmCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGabrg1
Plasmid#124870PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35S:dCas9:Tnos (GB1191)
Plasmid#68223PurposeTranscriptional unit for human codon optimized with mutated (D10A, H840A) and inactivated catalytic domains Cas9 protein plant expression driven by the 35S promoterDepositorInsertdCas9
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removed; human codon optimis…Promoter35SAvailable SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-dDNMT3a-C706S-Hygro
Plasmid#104412Purposetransient expression of dCas9-dDNMT3a fusion proteinDepositorInsertdDNMT3a
UseCRISPRExpressionMammalianMutationC706SPromoterCMV promoterAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-eSpCas9-D10A
Plasmid#80449Purposeenhanced SpCas9 mammalian expression vectorDepositorInsertehSpCas9_D10A
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCBhAvailable SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)
Plasmid#75400PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.DepositorInserthCas9
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV_UdgX-EE-UdgX-NG-nCas9-RBMX
Plasmid#163571PurposeMammalian CG-to-GC base editingDepositorInsertUdgX-EE-UdgX-NG-nCas9-RBMX
UseCRISPRExpressionMammalianMutationnCas9 (D10A)EE (R126E, R132E)NG (L111R, D1135V, G…Available SinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(-10AC12)_Psyn-sgRNArodA
Plasmid#149661Purposeall-in-one CRISPRi vector for targeting B. burgdorferi rodADepositorInsertdCas9, lacI, sgRNArodA
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30(-10AC12), PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAflaB
Plasmid#149588Purposeall-in-one CRISPRi vector for targeting B. burgdorferi flaBDepositorInsertdCas9, lacI, sgRNAflaB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40-hCas9 L3-L2
Plasmid#62133PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing SV40 promoter and human codon optimized Cas9 module. Compatible with MultiSite Gateway cloningDepositorInserthuman codon optimized Cas9
UseCRISPR; Mule gateway entry vectorExpressionMammalianPromoterSV40Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
(517) SB KRAB-SadCas9 U6-gStop
Plasmid#163023PurposeSleeping Beauty TET-On expression of CRISPRi with gSTOP gRNADepositorInsertMammalian codon-optimized SadCas9
UseTransposonTagsKRAB and myc NLSExpressionMammalianPromoterTet-OnAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNLS-SpCas9MT3-NLS-FKBP_SL
Plasmid#107305PurposeExpresses R1335K mutant SpCas9 fused to FKBP with extra NLS in mammalian cellsDepositorInsertSpCas9
UseCRISPRTags2x NLS and FKBPExpressionMammalianMutationR1335K and fused to FKBPPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-eSpCas9-H840A
Plasmid#80454Purposeenhanced SpCas9 mammalian expression vectorDepositorInsertehSpCas9_H840A
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCBhAvailable SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNAftsI
Plasmid#149590Purposeall-in-one CRISPRi vector for targeting B. burgdorferi ftsIDepositorInsertdCas9, lacI, sgRNAftsI
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
SIN-CMV-Cas9-V5-WPRE
Plasmid#87904PurposeTo produce lentiviral vector for gene editingDepositorInsertCas9-V5
UseLentiviralTagsV5Mutationhuman codon-optimizedPromoterCMVAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only