We narrowed to 4,708 results for: Bre;
-
Plasmid#110850PurposeLentiviral vector for constitutive expression of Cas9-HF1 (not codon optimized)DepositorInsertCas9-HF1
UseLentiviralTags3X FLAGMutationN497A, R661A, Q695A, Q926APromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VQR-PGK-Puro
Plasmid#110855PurposeLentiviral vector for constitutive expression of Cas9-VQR (not codon optimized)DepositorInsertCas9-VQR
UseLentiviralTags3X FLAGMutationD1135V, R1335Q, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-VRER-PGK-Puro
Plasmid#110856PurposeLentiviral vector for constitutive expression of Cas9-VRER (not codon optimized)DepositorInsertCas9-VRER
UseLentiviralTags3X FLAGMutationD1135V, G1218R, R1335E, T1337RPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX302 PCSK5 (T288P)-V5 puro
Plasmid#98709PurposeLentiviral vector for constitutive expression of human mutant PC5A (T288P) with C-terminal V5 tagDepositorInsertPCSK5 (PCSK5 Human)
UseLentiviralTagsV5ExpressionMammalianMutationChanged Threonine 288 to ProlineAvailable SinceAug. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-Fascin-Promoter (-210-0)
Plasmid#89826PurposeFascin promoter for luciferase assayDepositorAvailable SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.1_puro_shJUND #2
Plasmid#136583PurposeExpresses an inducible short hairpin targeting human JUND sequenceDepositorAvailabilityAcademic Institutions and Nonprofits only -
pT3-EF1A-mTert
Plasmid#162555PurposeOverexpression of TertDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Puro-IKBalpha-mut (super repressor)
Plasmid#15291DepositorInsertinhibitor of Kappa B alpha (NFKBIA Human)
UseRetroviralExpressionMammalianMutationS32A/S36A: “super-repressor” allele (resistant to…Available SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HA-ER Y537S
Plasmid#49499PurposeExpresses HA-tagged ER Y537S mutant in mammalian cellsDepositorAvailable SinceDec. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLX317-MBNL1
Plasmid#115443PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDRM209 LTP (Luciferase tdTomato Puro)
Plasmid#174723PurposeExpresses the firefly luciferase gene, E2A, tdTomato, T2A, and the puromycin resistance gene.DepositorInsertsFirefly Luciferase
tdTomato
pac
UseLentiviral and LuciferaseTagsE2A linker and T2A linkerExpressionMammalianPromoterMND, MND (off Luc-E2A), and MND (off Luc-E2A-tdTo…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet1-dCas9
Plasmid#136650PurposeTet1 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertTet1 (Tet1 Mouse)
UseCRISPRTags3XFLag-NLS-Tet1-dCas9-NLSExpressionMammalianPromoterCMVAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynaptoTAG2
Plasmid#175275PurposeAAV vector for mapping synaptic projections of infected neurons; expresses tdTomato to reveal neuronal soma and axons, and expresses EGFP fused to Synaptobrevin-2 to track synaptic terminals.DepositorInsertEGFP-Synaptobrevin-2; tdTomato (Vamp2 )
UseAAVTagsEGFP and tdTomato (P2A cleavage)PromoterSynapsinAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHTN_HaloTag_KIF5B
Plasmid#213404PurposeFull-length human kinesin-1 with HaloTag at the N-terminusDepositorAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1α-NES-Kinprola_PKA-mEGFP_bGH-PA term_EF1α_FLAG-SV40NLS-Cas9-NLS-T2A-BSD-WPRE-SV40
Plasmid#233371PurposeEF1α driven co-expression of the PKA activity recorder Kinprola_PKA fused to mEGFP and Cas9 expression through lentivirus transductionDepositorInsertsNES-Kinprola_PKA-mEGFP
FLAG-SV40NLS-Cas9-NLS-T2A-BSD
UseLentiviralTagsFLAG, NES, and mEGFPPromoterEF1αAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
IL6R PLAK1
Plasmid#161518PurposeExpresses IL6 receptor (full length) in mammalian cells.DepositorInsertInterleukin 6 Receptor (IL6R Human)
UseLentiviralAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hPDGFRA-GFP
Plasmid#22919DepositorInserthuman platelet derived growth factor receptor alpha polypeptide promoter driving GFP (PDGFRA Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDRM166 LKB (Luciferase mKate2 Blast)
Plasmid#183502PurposeExpresses the firefly luciferase gene, the NLS-tagged mKate2 gene, and the blasticidin resistance gene joined by P2A linkers.DepositorInsertsFirefly Luciferase
mKate2
BSD
UseLentiviral and LuciferaseTagsP2A linker and SV40 NLS with GGS linkerExpressionMammalianPromoterMND, MND (off Luc-P2A), and MND (off Luc-P2A-mKat…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.N
Plasmid#127851Purposenon-standard AAV2 rep-AAV-PHP.N cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.N VP1 gene
UseAAVExpressionMammalianPromoterp41Available SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HA-ER D538G
Plasmid#49500PurposeExpresses HA-tagged ER D538G mutant in mammalian cellsDepositorInsertESR1 (ESR1 Human)
TagsHAExpressionMammalianMutationAspartic acid 538 to GlycinePromoterCMVAvailable SinceDec. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAG_Xph20-mEos3.2-CCR5TC
Plasmid#135532PurposeEncodes a specific PSD-95 binder (Xph20) fused to mEos3.2, CCR5 left-handed zinc finger, and KRAB(A) transcriptional repressor domainDepositorInsertXph20
TagsmEos3.2ExpressionMammalianPromoterCAGAvailable SinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-FNLS-P2A-GFP-PGK-Puro
Plasmid#110869PurposeLentiviral vector for constitutive expression of FNLS-P2A-GFP in mammalian cells (codon optimized)DepositorInsertBE3RA-FNLS
UseLentiviralTags3X FLAGMutationD10A and NLS sequence at the N-terminusPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-1 TIM9,10
Plasmid#170280PurposeExpresses both yeast Tim9 and yeast Tim10 (the latter with cleavable N-ter His-tag), codon-optimized for E. coli productionDepositorInsertExpressionBacterialPromoterTim9: via NdeI/XhoI into the MCS2; Tim10: via Bam…Available SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21a(+)-Bst LF-6xHis
Plasmid#159148Purposeexpresses His-tagged large fragment of Bst polymeraseDepositorInsertlarge fragment of Geobacillus stearothermophilus DNA polymerase I
TagsHisExpressionBacterialAvailable SinceSept. 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGTag-eGFP-SV40
Plasmid#117813PurposeDonor for precise CRISPR directed genomic integration using the GeneWeld methodDepositorInserteGFP
UseSynthetic BiologyAvailable SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGTag-TagRFP-SV40
Plasmid#117807PurposeDonor for precise CRISPR directed genomic integration using the GeneWeld methodDepositorInsertTagRFP
UseSynthetic BiologyAvailable SinceFeb. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304-ERBB2
Plasmid#175846PurposeExpresses ERBB2DepositorAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBabe-GFP-IKBalpha-mut (super repressor)
Plasmid#15264DepositorInsertIKB alpha (NFKBIA Human)
UseRetroviralExpressionMammalianMutationSerine 32 to Alanine, Serine 36 to AlanineAvailable SinceJuly 12, 2007AvailabilityAcademic Institutions and Nonprofits only