We narrowed to 14,447 results for: cas9 genes
-
Plasmid#104397PurposeThe designed sgRNA cloned into this plasmid directs the specific DNA cleavage exerted by Cas9 nuclease in a region of exon 5 of the human TK2 gene. The plasmid also includes the Cas9 nuclease and CD4.DepositorAvailable SinceApril 13, 2018AvailabilityAcademic Institutions and Nonprofits only
-
PX406 Pasteurella multocida Cas9
Plasmid#68703PurposePasteurella multocida Cas9DepositorInsertPmCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35S:dCas9:Tnos (GB1191)
Plasmid#68223PurposeTranscriptional unit for human codon optimized with mutated (D10A, H840A) and inactivated catalytic domains Cas9 protein plant expression driven by the 35S promoterDepositorInsertdCas9
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removed; human codon optimis…Promoter35SAvailable SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGabrg1
Plasmid#124870PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-eSpCas9-D10A
Plasmid#80449Purposeenhanced SpCas9 mammalian expression vectorDepositorInsertehSpCas9_D10A
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCBhAvailable SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-dDNMT3a-C706S-Hygro
Plasmid#104412Purposetransient expression of dCas9-dDNMT3a fusion proteinDepositorInsertdDNMT3a
UseCRISPRExpressionMammalianMutationC706SPromoterCMV promoterAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)
Plasmid#75400PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.DepositorInserthCas9
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV_UdgX-EE-UdgX-NG-nCas9-RBMX
Plasmid#163571PurposeMammalian CG-to-GC base editingDepositorInsertUdgX-EE-UdgX-NG-nCas9-RBMX
UseCRISPRExpressionMammalianMutationnCas9 (D10A)EE (R126E, R132E)NG (L111R, D1135V, G…Available SinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40-hCas9 L3-L2
Plasmid#62133PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing SV40 promoter and human codon optimized Cas9 module. Compatible with MultiSite Gateway cloningDepositorInserthuman codon optimized Cas9
UseCRISPR; Mule gateway entry vectorExpressionMammalianPromoterSV40Available SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNLS-SpCas9MT3-NLS-FKBP_SL
Plasmid#107305PurposeExpresses R1335K mutant SpCas9 fused to FKBP with extra NLS in mammalian cellsDepositorInsertSpCas9
UseCRISPRTags2x NLS and FKBPExpressionMammalianMutationR1335K and fused to FKBPPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-eSpCas9-H840A
Plasmid#80454Purposeenhanced SpCas9 mammalian expression vectorDepositorInsertehSpCas9_H840A
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCBhAvailable SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-dHeFSpCas9-VP64-6xHis
Plasmid#92119PurposeExpression of dead/inactive increased fidelity HeFSpCas9-VP64-6xHis in bacterial cellsDepositorInsertdead/inactive HeFSpCas9-NLS-3xFLAG-VP64
UseCRISPRTags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A, N497A, R661A, Q695A, H840A, K848A, Q926A, K…PromoterT7Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
A3H HapII-Cas9n-UGI
Plasmid#119141PurposeBase editor made from APOBEC3H Haplotype IIDepositorInsertAPOBEC3H Haplotype II-Cas9 nickase-UGI
UseCRISPRMutationNonePromoterCMVAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX544 SpCas9(del1098-1368)
Plasmid#58889PurposeTruncated form of SpCas9 without C' domainDepositorInserthSpCas9
UseCRISPRTags3XFLAGExpressionMammalianMutationdel amino acids 1098-1368Available SinceSept. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEGB2alpha2 35s:hCas9:tNos (GB0639)
Plasmid#68222PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoterDepositorInserthCas9
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoter35SAvailable SinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsAGO3_AH
Plasmid#148855PurposeMammalian Expression of HsAGO3-sgRNADepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGabrg1
Plasmid#124856PurposeMutagenesis of Gabrg1DepositorInsertGabrg1 (Gabrg1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-VQR-GFP_activity_reporter
Plasmid#87156PurposeThis lentiviral vector can be used to assay activity of SpCas9-VQR (NGA PAM restricted).DepositorInsertGFP and sgRNA targeting GFP (NGA restricted)
UseLentiviralAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAWp63-clone32 (Opti-SpCas9)
Plasmid#131736PurposeExpresses Opti-SpCas9 in mammalian cellsDepositorInsertOpti-SpCas9
UseLentiviralTagsFlagMutationR661A+K1003HPromoterEFSAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only