182,758 results
-
Plasmid#104409Purposetransient expression of dCas9-HDAC1 fusion proteinDepositorInsertHDAC1 (HDAC1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterCMV promoterAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
p201N Cas9
Plasmid#59175PurposeCas9 driven by double 35S, nptII for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
nptII
UseCRISPRTagsExpressionMutationPromoter2x35S and StUbi-3PAvailable sinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV:cTNT::Luciferase
Plasmid#69915PurposeUsed to package AAV9:cTNT::luciferase. Specifically transduce cardiomyocytes.DepositorInsertFirefly luciferase
UseAAVTagsExpressionMutationPromoterChicken cardiac troponin TAvailable sinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pLentiPGK Puro DEST p38KTRClover
Plasmid#59152PurposeLentiviral vector to express p38 KTR mClover under PGK promoter (With Puromycin Resistance)DepositorInsertp38 Kinase Translocation Reporter (MAPK14 Human, Mouse)
UseLentiviralTagsExpressionMammalianMutationPromoterPGKAvailable sinceSept. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-VP64
Plasmid#47107PurposeExpresses inactivated S. pyogenes dCas9 (D10A, H840A) fused to VP64 transactivator domain in mammalian cellsDepositorInsertdCas9-VP64
UseCRISPRTagsFlag, HA, SV40 NLS, and VP64ExpressionMammalianMutationD10A, H840A (catalytically inactive)PromoterCMVAvailable sinceNov. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-mCherry (AAV Retrograde)
Viral Prep#114470-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-Ef1a-mCherry (#114470). In addition to the viral particles, you will also receive purified pAAV-Ef1a-mCherry plasmid DNA. EF1a-driven mCherry expression. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherryAvailable sinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lamin A (R435C)-mRFP
Plasmid#124274PurposeLamin A mutant (R435C), C-terminally tagged with mRFP. Mutation associated with Progeria.DepositorInsertLMNA (R435C) (LMNA Human)
UseTagsmRFPExpressionMammalianMutationLMNA (R435C)PromoterAvailable sinceMay 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
Str-Ii_VSVG-SBP-EGFP
Plasmid#65300Purposesynchronize trafficking of VSVG from the ER (RUSH system)DepositorInsertVSV-G
UseTagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianMutationPromoterCMVAvailable sinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
UseTagsExpressionMammalianMutationPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-P301L Tau
Plasmid#176267PurposeThis AAV plasmid vector expresses human 2N4R microtubule-associated protein tau with P301L mutation.DepositorInsertFlex-P301L tau (MAPT )
UseAAVTagsExpressionMutationPromoterAvailable sinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Tet-MKK6(DD)-Puro
Plasmid#86094PurposeTet/Dox inducible (TetR) constitutively active mutant MKK6/MAP2K6 in lentiviral vectorDepositorInsertMKK6 (MAP2K6 Human)
UseLentiviralTagsMyc tagExpressionMammalianMutationSerine 207 and Threonine 211 both changed to Aspa…PromoterCMV/TetOAvailable sinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-OTp-GCaMP6s
Plasmid#192945PurposeTo drive GCaMP6s under the control of mouse oxytocin promoterDepositorInsertGCaMP6s
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-mCherry-IRES-Flpo (AAV Retrograde)
Viral Prep#55634-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-EF1a-mCherry-IRES-Flpo (#55634). In addition to the viral particles, you will also receive purified pAAV-EF1a-mCherry-IRES-Flpo plasmid DNA. Flpo and bicistronic (IRES) mCherry expression under the EF1a promoter. These AAV preparations are suitable purity for injection into animals. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1a and Ef1a/IRESTagsmCherryAvailable sinceJuly 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag-Gsdmd
Plasmid#80950PurposeExpresses Gsdmd in mammalian cellsDepositorInsertGsdmd (Gsdmd Mouse)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pScaffold-H1 donor
Plasmid#118152PurposePCR template for dual guide RNA cloning, guide RNA scaffold for the Streptococcus pyogenes CRISPR/Cas9 system - H1 promoterDepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Fuw-dCas9-Dnmt3a-P2A-tagBFP
Plasmid#84569PurposeLentiviral construct to express dCas9 fused with Dnmt3a-P2A-tagBFPDepositorInsertdCas9-Dnmt3a (DNMT3A Human, Synthetic)
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP::L4440
Plasmid#11335DepositorInsertGFP
UseRNAiTagsExpressionWormMutationPromoterAvailable sinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Opto-zFGFR1a
Plasmid#232639PurposeZebrafish FGFR1a receptor kinase domain fused to VfLOVDepositorInsertzFGFR1a kinase domain + VfLOV domain
UseTagsExpressionMutationPromoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only