We narrowed to 23,297 results for: Tes
-
Plasmid#83466PurposeNegative control for HOP-flash. 7xmut TEAD binding sites with minimal promoter plus luciferase reporter geneDepositorInsertMultimerized mutated TEAD binding sites in the promoter of CTGF with minimal promoter (CCN2 Human)
UseLuciferaseAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO HA-AMPKa1 WT
Plasmid#69824PurposeExpresses AMPK alpha 1 in mammalian cells in a doxycycline inducible mannerDepositorInsert5'-AMP-activated protein kinase catalytic subunit alpha-1 (PRKAA1 Human)
UseLentiviralTagsHAExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
tetO-Hand2
Plasmid#46028DepositorAvailable SinceJuly 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET-15b-hAR-663-919
Plasmid#89083Purposebacterial expression of human androgen receptor ligand bindng domain amino acid residues 663-919 with histidine tagDepositorInserthAR ligand binding domain (AR Human)
TagsHisExpressionBacterialMutationaa 663-919PromoterT7Available SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2/V5-DEST RBM14-V5
Plasmid#69823PurposeExpresses RBM14-V5 in mammalian cellsDepositorInsertRNA-binding protein 14 (RBM14 Human)
UseRetroviralTagsv5ExpressionMammalianPromotercmvAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
hFLT1
Plasmid#83435Purposehuman VEGFR1 with HA and FLAG tagDepositorInserthuman VEGFR1 (FLT1 Human)
TagsFlag and MycExpressionMammalianMutationHA-tag was inserted 30 AA downstream of the FLT1 …PromoterCMVAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-3-GST-Tev-Af1521-myc
Plasmid#196239PurposeN-terminal GST fusion of Af1521(WT) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(WT) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2/V5-DEST MTFR1L-V5
Plasmid#69822PurposeExpresses MTFR1L-V5 in mammalian cellsDepositorInsertMitochondrial fission regulator 1-like (MTFR1L Human)
UseRetroviralTagsv5ExpressionMammalianPromotercmvAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT5_TRE-ARID1A-FLAG_PGK-H2B-RFP
Plasmid#203965PurposeDox inducible FLAG tag ARID1a in a sleeping beauty transposon constructDepositorInsertARID1A (Arid1a Mouse)
UseSleeping beauty transposonTagsFLAGExpressionMammalianPromoterTREAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVH-EF1a-GFP-P2A-OCT4
Plasmid#130692PurposeLentiviral plasmids encoding human OCT4 (POU5f1) along with GFP linked via P2A.DepositorInserthuman OCT4 (POU5F1 Human)
UseLentiviralAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-EcTrp-TGA
Plasmid#228780PurposeaaRS/tRNA system for incorporation of 5HTP within proteins in mammalian cells at TGA codonDepositorInsertsEcTrpRS
EcWtR
UseBaculoviralExpressionMammalianMutationTGA suppressorAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 FLAG FBXO31
Plasmid#236429Purposetransient overexpression of FBXO31 in mammalian cellsDepositorAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-EcTyr-TAG
Plasmid#228782PurposeEcTyr aaRS/tRNA system for mammalian ncAA incorporationDepositorInsertsEcTyrRS
EcYtR
BstR
UseBaculoviralExpressionMammalianMutationTAG suppressorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hPGK-eGFP-SynaptoZip
Plasmid#122523PurposeLentiviral expression of the synaptic activity-marker SynaptoZip fused to eGFP driven by hPGK promoterDepositorInserteGFP-SynaptoZip (Vamp2 Rat)
UseLentiviralTagsMyc and eGFPExpressionMammalianPromoterhPGKAvailable SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-ORP8-H514A-H515A
Plasmid#208360PurposeMammalian expression of fluorescent N-terminally tagged H514A-H515A mutant of ORP8DepositorAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVH-EF1a-GFP-P2A-KLF4
Plasmid#130694PurposeLentiviral plasmids encoding human KLF4 with co-expressoin of GFP mediated by P2A.DepositorInserthuman KLF4 (KLF4 Human)
UseLentiviralAvailable SinceAug. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1A-DTX2-1-178-EGFP-Hygro
Plasmid#238094PurposeExpression of structurally predicted WWE domain of DTX2 with EGFP on C terminalDepositorInsertDTX2 (DTX2 Human)
UseLentiviralTagsEGFPExpressionMammalianMutationaa 1-178 onlyPromoterEF1alphaAvailable SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
GAL-hAR-658-919
Plasmid#89082Purposemammalian expression of human androgen receptor ligand binding domain 658-919 amino acids linked to GAL4 DNA binding domainDepositorAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAP03-sp44/p21
Plasmid#120232PurposeCarries bidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites that can be amplified with homology sequence for refactoring.DepositorInsertbidirectional promoter cassette containing sp44 and p21 promoters and apramycin resistance gene flanked by two FRT sites
UseSynthetic BiologyMutationaac(3)IV (apramycin resistance gene)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only