-
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
PL-CRISPR.EFS.tRFP-gIfngr1-2
Plasmid#166480PurposeExpresses spCas9, tRFP and a gRNA targeting mouse Ifngr1DepositorInsertgRNA for mouse Ifngr1 (Ifngr1 Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 2 Spacer
Plasmid#172730PurposeEncodes Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyTagsExpressionMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterAvailable sinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Spike Display_Part 2 DO
Plasmid#172722PurposeEncodes a sfGFP dropout expression cassette in place of Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseTags3X-FLAG; Strep-Tag II; HRV 3C cut site; PDGFR-B T…ExpressionMammalianMutationEctodomain only (AAs 1-1208); 682-685 (furin site…PromoterCMVAvailable sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV1)
Viral Prep#83899-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsNoneAvailable sinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV9)
Viral Prep#83899-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsNoneAvailable sinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAc-His-hAR-2
Plasmid#89091Purposebaculovirus transfer vector for histidine-tagged full-length human androgen receptor, starts Met-Ala-His6-Met-hARDepositorInserthAR (AR Human)
UseTagsHisExpressionMammalianMutationPromoterAvailable sinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBS-KS-attB1-2-PT-SA-SD-2-mTagBFP2(11x7)
Plasmid#172066PurposeProtein trap plasmid for inserting mTagBFP2(11x7) into a phase 2 coding intronDepositorInsertmTagBFP2(11x7)
UseTagsExpressionInsectMutationPromoterAvailable sinceOct. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV Retrograde)
Viral Prep#83899-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxTagsNoneAvailable sinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGST2-TSG101 (2-145)
Plasmid#184810PurposeBacterial expression of TSG101 UEV domain (aa 2-145)DepositorInsertTSG101 (TSG101 Human)
UseTagsGSTExpressionBacterialMutationaa 2-145 onlyPromotertacAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLG018 (AVAST type 2)
Plasmid#157896PurposeExpresses the AVAST type 2 defense systemDepositorInsertAVAST type 2 (STAND ATPase with uncharacterized helical N-terminal domain)
UseTagsExpressionBacterialMutationPromoterAvailable sinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAc-His-hAR-2
Plasmid#89091Purposebaculovirus transfer vector for histidine-tagged full-length human androgen receptor, starts Met-Ala-His6-Met-hARDepositorInserthAR (AR Human)
UseTagsHisExpressionMammalianMutationPromoterAvailable sinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Myc-His(-)-HSulf-2
Plasmid#13004DepositorInserthuman sulfatase 2 (SULF2 Human)
UseTags6x His and MycExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Myc-His(-)-MSulf-2
Plasmid#13008DepositorInsertmouse sulfatase 2 (Sulf2 Mouse)
UseTags6xHis and MycExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-TAT-2-84-FLAG
Plasmid#35980DepositorInserttransactivating protein (tat )
UseTagsFlagExpressionMammalianMutationtat from HIV2 84 amino acidsPromoterAvailable sinceApril 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
3462 pSFFV-neo Bcl-2
Plasmid#8776DepositorInsertBcl-2 (Bcl2 Mouse)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 18, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRc/CMV2 Dvl-2-Myc
Plasmid#42194DepositorInsertDvl 2 (Dvl2 Mouse)
UseTagsMycExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-TAT-2-130-FLAG
Plasmid#35984DepositorInserttransactivating protein (tat )
UseTagsFlagExpressionMammalianMutationtat from HIV2 130 amino acidsPromoterAvailable sinceSept. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-V5-DGCR8-mDRBD1&2
Plasmid#51385DepositorInsertDGCR8 (DGCR8 Human)
UseTagsV5ExpressionMammalianMutationDRBD1 & DRBD2 mutant (A568K, A569K, A676K, S6…PromoterCMVAvailable sinceMarch 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro shSlp4-a #2
Plasmid#40070DepositorInsertSlp4-a shRNA-2
UseLentiviralTagsExpressionMutationPromoterU6Available sinceOct. 16, 2012AvailabilityAcademic Institutions and Nonprofits only