We narrowed to 8,392 results for: crispr grnas
-
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA5
Plasmid#100557PurposeExpresses MYC sgRNA5. Target sequence GAGAGGCAGAGGGAGCGAGCDepositorInsertMYC sgRNA5
PromoterU6Available SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJZC42
Plasmid#66564PurposesgRNA + 1XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 1XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF511_1
Plasmid#104044PurposeEncodes gRNA for 3' target of human ZNF511 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF511_2
Plasmid#104045PurposeEncodes gRNA for 3' target of human ZNF511 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_1
Plasmid#86314PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable SinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_2
Plasmid#86315PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJA46
Plasmid#59928PurposegRNA for cleavage at rde-1(D801) locus in C elegansDepositorInsertrde-1(D801) gRNA
UseCRISPRAvailable SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJA45
Plasmid#59927PurposegRNA for cleavage at rde-1(D718) locus in C elegansDepositorInsertrde-1(D718) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLC-BFP-FADD
Plasmid#75166PurposeLentiCRISPR-BFP with sgRNA targeting human FADDDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSNR52-sgTET
Plasmid#46923PurposeYeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoterDepositorInsertsgRNA targeting endogenous TRE elements of pTET07 promoter
UseCRISPRExpressionYeastPromoterSNR52Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-ldhA
Plasmid#102288PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting ldhA.DepositorInsertldhA gRNA
UseCRISPRExpressionBacterialPromoterpTetAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
1183_pAAV-U6-Ex14-gRNAd-CB-EmGFP
Plasmid#89061PurposeAAV-gRNA targeting the murine Ldlr geneDepositorInsertEmGFP
UseAAV and CRISPRExpressionMammalianPromoterChicken beta actin with partial CMV enhancerAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-gRNA-TAZ
Plasmid#86688PurposeExpresses a gRNA targeted to human TAZDepositorAvailable SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AKT3 gRNA (BRDN0001144935)
Plasmid#76218Purpose3rd generation lentiviral gRNA plasmid targeting human AKT3DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
DYRK1B gRNA (BRDN0001149418)
Plasmid#76621Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK1BDepositorAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only