We narrowed to 28,928 results for: CAL
-
Plasmid#73263PurposeExpresses dH6.2-actin fusion within mammalian cells. (dH6.2, FAP)DepositorInsertKozATG-dH6.2-2XG4S-actin (ACTB Synthetic, Human)
TagsThe FAP and actin are fused with 2 copies of a G4…ExpressionMammalianMutationThe dH6.2 FAP has one cysteine in each domain cha…PromoterCMVAvailable SinceMarch 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX(cre)-OCaMP-WPRE
Plasmid#229853PurposepAAV vector for Cre-dependent OCaMP (orange calcium indicator) expression under the control of hSyn promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-EF1a-FLEX(FLP)-OCaMP-WPRE
Plasmid#224936PurposepAAV vector for flippase(FLP)-dependent OCaMP (orange calcium indicator) expression under the control of EF1a promoterDepositorInsertOCaMP
UseAAVTags6xHisExpressionMammalianPromoterEf1aAvailable SinceJuly 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLViN-iRFP670-α-cateninΔβH
Plasmid#229706PurposeLentiviral expression of iRFP670-alpha-catenin-delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseLentiviralTagsiRFP670ExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-CTNNA1(α-catenin CRISPR KO)
Plasmid#229708PurposeKnockout of a-catenin in mammalian cells using CRISPR-Cas9 technologyDepositorAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninV-
Plasmid#229696PurposeTransient expression of GFP-alpha-cateninV- in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
TagsEGFPExpressionMammalianMutationL344PPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML390_YWHAQ-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227925PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertYWHAQ homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML389_YWHAB-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227926PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertYWHAB homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML600_COG8-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227911PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertCOG8 homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML357_CAV1-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227914PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertCAV1 homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML361_DCP1A-N-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227918PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertDCP1A homology arms with XTEN80-mEGFP-3xHA for insertion at N terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML366_HSPA1B-N-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227920PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertHSPA1B homology arms with XTEN80-mEGFP-3xHA for insertion at N terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML365_HSP90AA1-N-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227921PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertHSP90AA homology arms with XTEN80-mEGFP-3xHA for insertion at N terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML364_PSMB7-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227922PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertPSMB7 homology arms with XTEN80-mEGFP-3xHA for insertion at C terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML374_CLTA-N-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227893PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertCLTA homology arms with mEGFP-3xHA for insertion at N terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML384_NCLN-C-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227897PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertNCLN homology arms with mEGFP-3xHA for insertion at C terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML318_SEC23A-N-term_XTEN80-mEGFP-3xHA_pTMPLT
Plasmid#227903PurposeHomology repair template for genome engineering. Organelle endogenous marker expressing GFP and epitope tags for mass spectrometry.DepositorInsertSEC23A homology arms with XTEN80-mEGFP-3xHA for insertion at N terminus
UseCRISPRAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL delta PBM
Plasmid#202415PurposeExpression of GFP-tagged PODXL PDZ-binding motif mutation (PBM; doesn't bind NHERF1/2)DepositorAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIZ GFP PODXL FBM
Plasmid#202417PurposeExpression of GFP-tagged PODXL FERM-binding motif mtuation (FBM; doesn't bind Ezrin)DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only