We narrowed to 2,589 results for: GCG
-
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD 3R-3E
Plasmid#188148PurposeExpresses C-terminal flag-tagged human CAD 3R-3E in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX335_U6-Chimeric_BB-CBh-hSpCas9n(D10A)_SOX17_Ex2_KI
Plasmid#195502PurposeCas9 nickase expression vector bearing a sgRNA targeting Exon 2 of human SOX17DepositorAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCHAT)-PGKpuro2ABFP-W
Plasmid#163147PurposeLentiviral gRNA plasmid targeting human CHAT gene, co-expression of BFP tagDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCdkn2c#2/Cre
Plasmid#173584PurposeExpresses a Cdkn2c-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Cdkn2c (Cdkn2c Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2ABFP-W
Plasmid#163175PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgAtrx#2/Cre
Plasmid#173616PurposeExpresses a Atrx-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Atrx (Atrx Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgArhgap35#1/Cre
Plasmid#173569PurposeExpresses a Arhgap35-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Arhgap35 (Grlf1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgAMBRA1#2
Plasmid#174147PurposeLentiviral vector expressing a sgRNA against the human AMBRA1 geneDepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458-AMBRA1 (optimized for N-terminal knock-in)
Plasmid#172608PurposeExpresses a gRNA against AMBRA1 and Cas9 from S. pyogenes with 2A-EGFP. This gRNA is suitable for the N-terminal knock-in of AMBRA1.DepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2ABFP-W
Plasmid#163170PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2AmCherry-W
Plasmid#163172PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-Kmt2c-3
Plasmid#162533PurposesgRNA targeting Kmt2cDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-Kmt2b-3
Plasmid#162537PurposesgRNA targeting Kmt2bDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgCh2-2
Plasmid#125767Purposeconstitutive expression of a guide RNA targeting an intergenic region of human chromosome 2 (CRISPR cutting control)DepositorInsertsgCh2-2
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
DDR1 gRNA (BRDN0001145659)
Plasmid#78010Purpose3rd generation lentiviral gRNA plasmid targeting human DDR1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSNK1E gRNA (BRDN0001147706)
Plasmid#77978Purpose3rd generation lentiviral gRNA plasmid targeting human CSNK1EDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GCK gRNA (BRDN0001147104)
Plasmid#77583Purpose3rd generation lentiviral gRNA plasmid targeting human GCKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GUCY2D gRNA (BRDN0001146190)
Plasmid#76032Purpose3rd generation lentiviral gRNA plasmid targeting human GUCY2DDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-LRRK2-G2019S-3b
Plasmid#180433PurposeTransiently expressing a pegRNA to introduce LRRK2-G2019S mutation in human cellsDepositorInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianMutationLRRK2-G2019SPromoterU6AvailabilityAcademic Institutions and Nonprofits only