We narrowed to 14,352 results for: Cas9
-
Plasmid#118385PurposeEntry clone containing CAS9p and 35S terminator. Used to make CRISPR construct . For use in plants and compatible with the MultiSite Gateway systemDepositorInsertCAS9p
UseCRISPRAvailable sinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDGE78
Plasmid#80580Purposerecipient plasmid [multiplexing, nickase]; pPcUbi:Cas9 D10A, nptIIDepositorInsertspnos:nptII-tmos
pPcUbi:Cas9 D10A-tnos
BsaI-ccdB_CmR-BsaI
UseCRISPRExpressionPlantMutationD10AAvailable sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-dCas9-MQ1(WT)-EGFP
Plasmid#89633PurposeTargeted CpG methylationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsite-specific DNA-methyltransferase SssI
UseCRISPRTags3*FLAG and 6*HisExpressionMammalianPromoterCMVAvailable sinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJCHph
Plasmid#185863PurposeThe CRISPR/Cas9-and-gRNA-expressing plasmid with a hygromycin B-resistent selectable markerDepositorInsertPTDH3-Cas9(N); PSNR52-srRNA-TSUP4; HphMX6
ExpressionYeastMutationNoneAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3
Plasmid#86611PurposeExpresses the ATP1A1 G3 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 4. Px330-like plasmidDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDY1330 STITCHR pCMV-nCas9-XTEN-v170_R2Tocc
Plasmid#234826PurposeSTITCHR R2Tocc editorDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertnCas9h840a-xten-R2Tocc
UseCRISPRAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-nSpCas9-P2A-EGFP (KAC978)
Plasmid#185910PurposepCMV and pT7 plasmid encoding human codon optimized ABE8e A-to-G base editor with nickase SpCas9(D10A) and P2A-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized ABE8e-nSpCas9-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationnSpCas9=D10APromoterCMV and T7Available sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLPB2B-ER50-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187948PurposeER50 degron-tagged dCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertER50-SpdCas9-tagRFPt-P2A-tagBFP
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianMutation6 mutations, T371A, L384M, M421G, G521R, Y537S, N…Available sinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYN2_1
Plasmid#184757PurposePlasmid for genome editing by CRISPR/Cas9DepositorInsertsCas9
sgRNA scaffold where sfGFP is replaced with gRNA protospacer of interest, which will be proceeded by the HDV Ribozyme
UseSynthetic BiologyTags2xNLSExpressionBacterial and YeastPromoterPGK1 and tRNA-Phe-HDV RibozymeAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-dCas9-TurboID-blast
Plasmid#222599PurposeExpress fussed dCas9-TurboID for proximity labelingDepositorInsertdCas9-TurboID
UseLentiviralPromoterEF-1αAvailable sinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-TRE3G-dCas9-HaloTag
Plasmid#169448Purposeexpression of dCas9-HaloTagDepositorInsertdCas9-HaloTag
UseLentiviralExpressionMammalianAvailable sinceJune 13, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LLP185 pLVP-dCas9-DNMT3a V2
Plasmid#100936PurposedCas9 and DNMT WT on C terminus, 4 NLS, driven by pGK promoter, with P2A site and PURO gene, within a lentiviral transfer backboneDepositorInsertdCas9, DNMT3a catalytic domain (DNMT3A Human, S.pyogenes)
UseCRISPR and LentiviralTags3xHA and 3xTy1ExpressionMammalianMutationD10A, H840A for dCas9Available sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-PE2-SpRY
Plasmid#159979PurposePrime editing in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPE2-SpRY
TagsBpSV40 NLSExpressionMammalianPromoterCMVAvailable sinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-EN1082_Rad21_STOP
Plasmid#156450PurposeFor transient expression of Cas9 and sgRNA targeting mouse RAD21 stop codonDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9, RAD21 (Rad21 Mouse)
UseCRISPRExpressionMammalianMutationnoneAvailable sinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lenti CAG-FLAG-dCas9-VPR
Plasmid#114197PurposeLentivirus compatible dCas9-VPR construct driven by the CAG promoterDepositorInsertdCas9-VPR
UseLentiviralTagsFLAGExpressionMammalianPromoterCAGAvailable sinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRDA_479
Plasmid#179099PurposeBE Cas expressionDepositorInsertABE8e (SpG)
UseCRISPR and LentiviralAvailable sinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC19-Q03JI6
Plasmid#103123PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertQ03JI6 (Cas9 coding gene from Campylobacter jejuni)
UseCRISPR; Cloning vectorTagsSV40NLSMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E9S7M7
Plasmid#103106PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE9S7M7(Cas9 coding gene from Ruminococcus albus 8)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable sinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only