Skip to main content

We narrowed to 13,608 results for: crispr cas9

Showing: 2541 - 2560 of 13608 results
  1. pLenti-dSaCas9-KRAB-gRNA-TRE-blast

    Plasmid
    #201151
    Purpose
    Lentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.
    Depositor
    Inserts
    SadCas9-KRAB
    gRNA-TRE
    Use
    CRISPR and Lentiviral
    Tags
    HA
    Mutation
    gRNA sequence: ATCAGTGATAGAGAACGTATG
    Available Since
    July 25, 2023
    Availability
    Academic Institutions and Nonprofits only
  2. A3Bi-ctd-Cas9n-UGI-NLS

    Plasmid
    #109426
    Purpose
    Expresses the C-terminal catalytic domain of human APOBEC3B containing an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.
    Depositor
    Insert
    Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B C-terminal domain (APOBEC3B Human)
    Use
    CRISPR
    Expression
    Mammalian
    Mutation
    Insertion of an L1 intron into the coding sequenc…
    Promoter
    CMV
    Available Since
    July 2, 2018
    Availability
    Academic Institutions and Nonprofits only
  3. A3Ai E72A-Cas9n-UGI-NLS

    Plasmid
    #109430
    Purpose
    Expresses catalytically inactive human APOBEC3A with an L1 intron fused to Cas9n, Uracil DNA Glycosylase Inhibitor, with a nuclear localization signal.
    Depositor
    Insert
    Apolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-Like 3A E72A Catalytic Mutant (APOBEC3A Human)
    Use
    CRISPR
    Expression
    Mammalian
    Mutation
    Insertion of an L1 intron into the coding sequenc…
    Promoter
    CMV
    Available Since
    July 2, 2018
    Availability
    Academic Institutions and Nonprofits only
  4. pJSC129 - Bacterial expression plasmid for SpCas9-HF1, REC2 FRET variant

    Plasmid
    #101211
    Purpose
    Bacterial expression plasmid for SpCas9-HF1, REC2 FRET variant
    Insert
    SpCas9 variant C80S/C574S/E60C/D273C/N497A/R661A/Q695A/Q926A
    Tags
    10x His, MBP, and TEV site
    Expression
    Bacterial
    Mutation
    C80S, C574S, E60C, D273C, N497A, R661A, Q695A and…
    Promoter
    T7
    Available Since
    Nov. 7, 2017
    Availability
    Academic Institutions and Nonprofits only
  5. pJSC057 - Bacterial expression plasmid for SpCas9∆REC3, REC2 FRET variant

    Plasmid
    #101204
    Purpose
    Bacterial expression plasmid for SpCas9∆REC3, REC2 FRET variant
    Insert
    SpCas9 variant C80S/C574S/E60C/D273C/M1–N497,GGS,V713–D1368
    Tags
    10x His, MBP, and TEV site
    Expression
    Bacterial
    Mutation
    C80S, C574S, E60C, D273C, M1-N497, GGS, V713-D1368
    Promoter
    T7
    Available Since
    Nov. 7, 2017
    Availability
    Academic Institutions and Nonprofits only
Showing: 2541 - 2560 of 13608 results