We narrowed to 535 results for: Atm
-
Plasmid#164826PurposeLentiviral vector for constitutive expression of AntiHER2 4D5-WT-Highest CARDepositorInsertAntiHER2 4D5-WT Chimeric Antigen receptor (CD8alphaTM-41BB-CD3z)
UseLentiviralTagsExpressionMutationPromoterSFFVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
XLone-ETV2
Plasmid#135763Purposeexpresses human ETV2 upon doxycycline treatmentDepositorInsertETV2 (ETV2 Human)
UseTagsExpressionMammalianMutationnonePromoterTRE3GAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR_SFFv_4D5-High-CAR_RHL002
Plasmid#164825PurposeLentiviral vector for constitutive expression of AntiHER2 4D5-High CARDepositorInsertAntiHER2 4D5-High Chimeric Antigen receptor (CD8alphaTM-41BB-CD3z)
UseLentiviralTagsExpressionMutationPromoterSFFVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
XLone-SOX17
Plasmid#135764Purposeexpresses human SOX17 upon doxycycline treatmentDepositorInsertSOX17 (SOX17 Human)
UseTagsExpressionMammalianMutationnonePromoterTRE3GAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR_SFFv_4D5-Low-CAR_RHL001
Plasmid#164824PurposeLentiviral vector for constitutive expression of AntiHER2 4D5-Low CARDepositorInsertAntiHER2 4D5-Low Chimeric Antigen receptor (CD8alphaTM-41BB-CD3z)
UseLentiviralTagsExpressionMutationPromoterSFFVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
XLone-SOX18
Plasmid#163822Purposeexpresses human SOX18 upon doxycycline treatmentDepositorInsertSOX18 (SOX18 Human)
UseTagsExpressionMammalianMutationPromoterTRE3GAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_2
Plasmid#102969PurposeSuppression of ABCB7DepositorInsertshABCB7_2 (ABCB7 Human)
UseLentiviral and RNAiTagsExpressionMutationPromoterAvailable sinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_1
Plasmid#102968PurposeSuppression of ABCB7DepositorInsertshABCB7_1 (ABCB7 Human)
UseLentiviral and RNAiTagsExpressionMutationPromoterAvailable sinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHCas9-Nours
Plasmid#107733PurposeEscherichia coli- S. cerevisiae shuttle plasmid harbors a Cas9 gene, a natMX6 and URA3 selection markers used in S. cerevisiaeDepositorInsertCas9
UseCRISPRTagsSV40 NLSExpressionYeastMutationHuman optimizedPromoterTEF1Available sinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pFRT-TODestFLAGHA_RBPMS_KDR_K100E
Plasmid#65093PurposeDestination vector with RBPMS resistant to siRNA treatment by s21729 (Applied Biosystems) with K100E mutation for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
UseTagsFLAG HAExpressionMammalianMutationchanged lysine 100 to glutamic acid (KDR backgrou…PromoterCMV, 2x TetAvailable sinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR_F65A
Plasmid#65092PurposeDestination vector with RBPMS resistant to siRNA treatment by s21729 (Applied Biosystems) with F65A mutation for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
UseTagsFLAG HAExpressionMammalianMutationchange phenylalanine 65 to alanine (KDR backbone)PromoterCMV, 2x TetAvailable sinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEasyG1_nat
Plasmid#184911PurposeTemplate to generate via PCR a single gRNA for expression in S. cerevisiaeDepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterial and YeastMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_nat
Plasmid#184918PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_nat recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
UseTagsExpressionBacterial and YeastMutationPromoterAvailable sinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB027
Plasmid#119712PurposeMultipartite assembly obtained by combining FB parts FB026+FB003 into pDGB3omega1. Used for fluorescent tagging of fungi (Hyg resistance +YFP) according to FungalBraid modular DNA assembly for ATMTDepositorInsertPgpdA::YFP::TtrpC(←)-PtrpC::hph::Ttub (→)
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDSM-ab-Psptef1-NAT-Ttip1
Plasmid#127747PurposeYeast pathway position 2. NatMX transcription unit with the S. paradoxus TEF1 promoter and TIP1 terminator. Nourseothricin resistance.DepositorInsertnourseothricin N-acetyltransferase
UseSynthetic BiologyTagsExpressionYeastMutationPromoterPsptef1Available sinceNov. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB012
Plasmid#119709PurposeComplete TU for hygromicin resistance in fungi, domesticated into pUPD2 with AATG/GCTT barcodes. Used for gene KO with dual selection, according to FungalBraid modular DNA assembly for ATMTDepositorInsertPtrpC:hph:Ttub
UseSynthetic Biology; Domestication of dna parts for…TagsExpressionMutationPromoterAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
FB039
Plasmid#119715PurposeMultipartite assembly obtained by combining FBparts FB026+FB009 into pDGB3omega1. Used for fluorescent tagging of fungi (G418 resistance + YFP), according to FungalBraid modular DNA assembly for ATMT.DepositorInsertPgpdA::YFP::TtrpC(←)-PtrpC:nptII::Ttub (→)
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB010
Plasmid#119708PurposeTranscriptional Unit (TU) for hygromicin resistance in fungi obtained by combining FB001+GB0211+FB002 into pDGB3alpha1. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPtrpC:hph:Ttub
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFRT-TODestFLAGHA_RBPMS_KDR
Plasmid#65091PurposeDestination vector with RBPMS resistant to siRNA treatment by s21729 (Applied Biosystems) for stable cell line generationDepositorInsertRBPMS (RBPMS Human)
UseTagsFLAG HAExpressionMammalianMutationchanged sequence to render plasmid resistant to s…PromoterCMV, 2x TetAvailable sinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSUC2::GNSI (NrsR)
Plasmid#121537PurposeThis plasmid contains a CYC1pr driven GNSI reporter and flanking homology to SUC2. Digestion with NotI, SacI, and EcoRV, allows integration at the SUC2 locus.DepositorInsertsCYC1 Promoter (CYC1 Budding Yeast)
Nyv1 Cytosolic Domain (aa 6-230)
Snc1 Transmembrane Domain (TMD)
SUC2 CDS
SUC2 terminator
NrsR
UseTagsmGFP5ExpressionYeastMutationM109I (Naturally occurring SNP) and The first 21 …PromoterAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_nat
Plasmid#184914PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_nat recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
FB003
Plasmid#119677PurposeTranscriptional Unit (TU) for hygromicin resistance in fungi obtained by combining FB001+GB0211+FB002 into pDGB3alpha2. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPtrpC:hph:Ttub
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEG302-MSI1-ZF
Plasmid#200912PurposeExpress MSI1-ZF108 in Arabidopsis target FWA geneDepositorInsertMSI1 (MSI1 Mustard Weed)
UseTagsExpressionPlantMutationPromoterAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
trp1D-proLYS2-GFP-PKCdelta(C1a+C1b)-NAT
Plasmid#184774PurposeMarker for DAG. Yeast expression of mouse PKCdelta under LSY2 promoter. Uses antibiotic resistance marker natMX6. Replaces endogenous TRP1 upon genome integration, leading to trp1D.DepositorInsertproLYS2-GFP-PKCdelta(C1a+C1b) (Prkcd Mouse, Budding Yeast)
UseTagsEGFPExpressionYeastMutationPromoterAvailable sinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v2
Plasmid#195139Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_Gal4UAS_4D5-High-CAR-mCherry_PGK_4D5-Low-SynNotch_Gal4VP64_RHL133
Plasmid#164822PurposeLentiviral vector for Gal4 inducible AntiHER2 4D5-High CAR-mCherry and constitutive expression of antiHER2 4D5-Low Gal4VP64 Synthetic NotchDepositorInsertsAntiHER2 4D5-High Chimeric Antigen receptor (CD8alphaTM-41BB-CD3z)
AntiHER2 4D5-Low Gal4VP64 synthetic Notch receptor
UseLentiviralTagsmCherryExpressionMutationPromoterminiCMV and pGKAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
EF1a_Puro_Telo_v1
Plasmid#195138Purpose~100 repeats of the human telomere seed sequence fused to the puromycin resistance gene; digest with BstZ17I-HF and KpnI-HF to obtain transfectable construct for chromosomal arm loss inductionDepositorInsertTelomere (RTEL1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_Gal4UAS_4D5-Low_CAR-mCherry_pGK_4D5-Low_SynNotch_RHL183
Plasmid#164827PurposeLentiviral vector for Gal4 inducible AntiHER2 4D5-Low CAR-mCherry and constitutive expression of antiHER2 4D5-Low Gal4VP64 Synthetic NotchDepositorInsertsAntiHER2 4D5-Low Chimeric Antigen receptor (CD8alphaTM-41BB-CD3z)
AntiHER2 4D5-Low Gal4VP64 synthetic Notch receptor
UseLentiviralTagsmCherryExpressionMutationPromoterminiCMV and pGKAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR_Gal4UAS_4D5-Low_CAR-mCherry_pGK_4D5-Medium_SynNotch_RHL144
Plasmid#164828PurposeLentiviral vector for Gal4 inducible AntiHER2 4D5-Low CAR-mCherry and constitutive expression of antiHER2 4D5-Medium Gal4VP64 Synthetic NotchDepositorInsertsAntiHER2 4D5-Low Chimeric Antigen receptor (CD8alphaTM-41BB-CD3z)
AntiHER2 4D5-Medium Gal4VP64 synthetic Notch receptor
UseLentiviralTagsmCherryExpressionMutationPromoterminiCMV and pGKAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-GFP-ATL1-G20TM
Plasmid#109019Purposestable lentiviral expression of cDNADepositorInsertATL1-deltaTM (ATL1 Human)
UseLentiviralTagseGFPExpressionMammalianMutationtruncated form without C-terminal ER transmembran…PromoterEIF-1a promoterAvailable sinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
FB009
Plasmid#119707PurposeTranscriptional Unit (TU) for geneticin (G418) resistance in fungi obtained by combining FB001+FB005+FB002 into pDGB3alpha2. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPtrpC::nptII::Ttub
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
FB026
Plasmid#119711PurposeTranscriptional Unit (TU) for YFP expression, obtained by combining FB/GBparts FB007+GB0053+FB008 into pDGB3alpha1R. According to FungalBraid/GoldenBraid modular DNA assembly for ATMTDepositorInsertPromoter gpdA:YFP coding sequence:Terminator trpC
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only