We narrowed to 3,387 results for: psin
-
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorInsertmScarlet-Gphn (isoform P1) (Gphn Rat, Synthetic)
UseAAVTagsmScarletExpressionMutationPromoterAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorInsertmScarlet-Gphn (isoform C4c) (Gphn Rat, Synthetic)
UseAAVTagsmScarletExpressionMutationPromoterAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
PHR-GFP-VP16
Plasmid#183927PurposeOptogenetic PHR domain coupled to GFP and VP16 activation domain; binds to CIBN upon blue light exposureDepositorUseTagsExpressionMammalianMutationnonePromoterCMVAvailable sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsUseTagsExpressionBacterialMutationPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-SspB (pBS1075)
Plasmid#185299PurposeMammalian expression of sleeping chironomid protein PvLEA4_repeats_k3_26 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertpvLEA22mer_shuffle_3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHN_VrDHN1a_mCh-SspB (pBS1074)
Plasmid#185298PurposeMammalian expression of riverbank grape plant protein DHN_VrDHN1a attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertPvLEA4_repeats_k3_26
UseTagsExpressionMammalianMutationPromoterAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_47-300_mCh-SspB (pBS1071)
Plasmid#185294PurposeFor the mammalian expression of the human protein ApoE3_D125I_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_D125I_47-300
UseTagsExpressionMammalianMutationD125IPromoterAvailable sinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_D125I_mCh-SspB (pBS1145)
Plasmid#185327PurposeFor the mammalian expression of the human protein ApoE3_D125I attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_D125I
UseTagsExpressionMammalianMutationD125IPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE4_mCh-SspB (pBS1143)
Plasmid#185325PurposeFor the mammalian expression of the human protein ApoE4 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE4
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_3_mCh-SspB (pBS1080)
Plasmid#185303PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertpvLEA22mer_mutant_3
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k5_1_mCh-SspB (pBS1079)
Plasmid#185302PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_1 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertPvLEA4_repeats_k5_1
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_10_mCh-SspB (pBS1078)
Plasmid#185301PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_10 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertpvLEA22mer_mutant_10
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
CAHS2_PARRC_98-130_mCh-SspB (pBS1077)
Plasmid#185300PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC_98-130 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertCAHS2_PARRC_98-130
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DSUP_RAMVA_1-208_mCh-SspB (pBS1073)
Plasmid#185296PurposeFor the mammalian expression of the tardigrade protein DSUP_RAMVA_1-208 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertDSUP_RAMVA_1-208
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHR93_Nccapped_mCh-SspB (pBS1072)
Plasmid#185295PurposeFor the mammalian expression of the synthetic protein DHR93_Nccapped attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertDHR93_Nccapped
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_47-300_mCh-SspB (pBS1070)
Plasmid#185293PurposeFor the mammalian expression of the human protein ApoE3_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_47-300
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE4_47-300_mCh-SspB (pBS1069)
Plasmid#185292PurposeFor the mammalian expression of the human protein ApoE4_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE4_47-300
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE2_47-300_mCh-SspB (pBS1068)
Plasmid#185291PurposeFor the mammalian expression of the human protein ApoE2_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE2_47-300
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLPS2-CAHS2_PARRC::SspB (pBS1043)
Plasmid#185290PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertCAHS2_PARRC
UseTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLPS1-FUSN:SspB (pBS1041)
Plasmid#185288PurposeFor the mammalian expression of the human protein FUSN attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertFUSN
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only