We narrowed to 2,775 results for: SAB;
-
Plasmid#212322PurposeEGFP-tagged IARS1DepositorInsertIARS (IARS1 Human)
UseTagsEGFPExpressionMammalianMutationWildtypePromoterCMVAvailable sinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
EK0397 3FLAG-ADAR1-p150-HIS (pEAQ)
Plasmid#191172PurposeHuman ADAR1, p150 isoform in plant-expressable format.DepositorInsert3FLAG-ADAR1-p150-HIS (plant) (ADAR Human)
UseTags3FLAG and HISExpressionPlantMutationWTPromoterAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-C2m2-SNAP
Plasmid#208791PurposeFor AAV production to express C2m2-SNAP in astrocytesDepositorInsertC2m2-SNAP (Mfge8 Mouse)
UseAAVTagsSNAP-tagExpressionMammalianMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterGFAP promoterAvailable sinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEZYeGFP-SARS-CoV-2E GGG
Plasmid#224582PurposeTo express a GFP tagged version of the Envelope protein of SARS-CoV-2 with a mutated PBM in mammalian cellsDepositorInsertSARS-CoV-2E GGG (E SARS-CoV-2)
UseTagsGFPExpressionMammalianMutationPBM (LLV) mutated to GGGPromoterCMVAvailable sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1430
Plasmid#29225PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorInsertPle170 (POGZ Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1641
Plasmid#29283PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle170 (POGZ Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSExpressionMutationPromoterAvailable sinceNov. 3, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEZYeGFP-SARS-CoV-2E stop
Plasmid#224581PurposeTo express a GFP tagged version of the Envelope protein of SARS-CoV-2 lacking its PBM in mammalian cellsDepositorInsertSARS-CoV-2E stop (E SARS-CoV-2)
UseTagsGFPExpressionMammalianMutationstop codon before PBMPromoterCMVAvailable sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa human
Plasmid#224578PurposeTo stably downregulate the expression of human DGK alfa in human cellsDepositorInsertsh RNAi Diacylglycerol kinase alfa human (DGKA Human)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28 mOct4-POU
Plasmid#206393PurposeExpresses the DNA binding domain of the Oct4 with a 6xHis tag for protein purificationDepositorInsertOct4 (Pou5f1 Mouse)
UseTags6xHisExpressionBacterialMutationPOU DNA binding domain onlyPromoterAvailable sinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCK302
Plasmid#87768PurposeAs pCK301 (E. coli rhaBAD promoter upstream of sfGFP, sfGFP can be replaced with any gene of interest), but rhaS cloned downstream of ampR, which allows non-metabolisable inducer L-mannose to be usedDepositorInsertsPrhaBAD-sfGFP
rhaS from E. coli with its native RBS from E. coli
UseSynthetic BiologyTags6xHis TagExpressionBacterialMutationPromoterPrhaBAD rhamnose-inducible promoter from E. coli …Available sinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-IARS1[W435C]-GFP
Plasmid#212323PurposeEGFP-tagged IARS1 Trp435CysDepositorInsertIARS (IARS1 Human)
UseTagsEGFPExpressionMammalianMutationTrp435cysPromoterCMVAvailable sinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-5xA
Plasmid#91979PurposeExpresses FLAG-HA-AGO2 [S824A, S828A, T830A, S831A, S834A (5xA)]DepositorInsertAGO2 (AGO2 Human)
UseLentiviralTagsFLAG-HAExpressionMammalianMutationS824A, S828A, T830A, S831A, S834A (5xA)PromoterAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-5xE
Plasmid#91981PurposeExpresses FLAG-HA-AGO2 [S824E, S828E, T830E, S831E, S834E (5xE)]DepositorInsertAGO2 (AGO2 Human)
UseLentiviralTagsFLAG-HAExpressionMammalianMutationS824E, S828E, T830E, S831E, S834E (5xE)PromoterAvailable sinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetO-lox-ERAS
Plasmid#52417PurposeDoxycycline inducible lentiviral vector of human ERAS cDNA with excisable insertDepositorInsertERAS (ERAS Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorInsertsh RNAi Diacylglycerol kinase zeta mouse (Dgkz Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available sinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-hMICU1EF
Plasmid#199180PurposeThis plasmid is used to express a EF-hand disabled human MICU1 protein in E. coli. The protein is fused with a maltose binding protein in the N-terminus, and also contains a C-terminal His6 tag.DepositorInsertMICU1 (MICU1 Human)
UseTagsHis6 and MBP, Thrombin site, TEV siteExpressionMutationD421A, E432K, F433W, F453WPromoterAvailable sinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only