We narrowed to 2,801 results for: SAB
-
Plasmid#91978PurposeExpresses FLAG-HA-AGO2 (WT)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pmCherry C1 Omp25
Plasmid#157758PurposeExpression of mcherry-labelled mitochondrial outer membrane protein 25 in cellsDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
fluoPEER-GFP>BFP
Plasmid#185477PurposeFluorescent reporter for a Y66H mutation to convert a GFP to BFP.DepositorInsertGFP-Y66-editing-site
ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-elavl3-H2B-GCaMP6s
Plasmid#59530PurposeExpressed nuclear-localized GCaMP6-slow, a calcium indicator, in neurons in zebrafish larva. The plasmid is in Tol2 transposon backboneDepositorInsertsUseTransposable elementAvailable SinceSept. 12, 2014AvailabilityAcademic Institutions and Nonprofits only -
fluoPEER-HEK3_5bp-del
Plasmid#185476PurposeFluorescent reporter for a 5 basepair deletion at the HEK3 locus.DepositorInsertHEK3 editing site
ExpressionMammalianPromoterCMVAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pegRNA-HEK3_del1-5-NGG
Plasmid#185478PurposepegRNA plasmid in order to make a 5 basepair deletion at the HEK3 locus, uses an NGG-PAM site.DepositorInsertHEK3_del1-5-NGG pegRNA
ExpressionMammalianPromoterU6Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET21a-C2m2-SNAP
Plasmid#208773PurposeTo express C2m2-SNAP in bacteriaDepositorInsertC2m2-SNAP (Mfge8 Mouse)
TagsSNAP-tagExpressionBacterialMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterT7 promoterAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shLuc.mKO2
Plasmid#85224PurposeshLuc (Target TTACGCTGAGTACTTCGA) for silencing luciferase gene as a control and express monomeric Kusabira-Orange2.DepositorInsertFirefly Luciferase
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEZYeGFP-SARS-CoV-2E
Plasmid#224580PurposeTo express a GFP tagged version of the Envelope protein of SARS-CoV-2 in mammalian cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21a-C2m2-mKate
Plasmid#208765PurposeTo express C2m2-mKate in bacteriaDepositorInsertC2m2-mKate (Mfge8 Mouse)
TagsmKateExpressionBacterialMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterT7 promoterAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-R438E
Plasmid#91984PurposeExpresses FLAG-HA-AGO2 (R438E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-K525E
Plasmid#91985PurposeExpresses FLAG-HA-AGO2 (K525E)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-D358K
Plasmid#91983PurposeExpresses FLAG-HA-AGO2 (D358K)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-FH-AGO2-S828A
Plasmid#91982PurposeExpresses FLAG-HA-AGO2 (S828A)DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSuper DGK zeta human
Plasmid#224575PurposeTo downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa mouse
Plasmid#224576PurposeNegative Control for downregulation of the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta human
Plasmid#224579PurposeTo stably downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only