We narrowed to 2,783 results for: SAB
-
Plasmid#224575PurposeTo downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pSuper Retro GFP DGK alfa mouse
Plasmid#224576PurposeNegative Control for downregulation of the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta human
Plasmid#224579PurposeTo stably downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJet-CMV-IARS1-GFP
Plasmid#212322PurposeEGFP-tagged IARS1DepositorAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORTMAGE311B
Plasmid#120418PurposeExpresses Lambda Beta and a dominant negative MutL E32K allele, controlled by XylS-Pm expression system for high precision and efficient MAGE experiments at 37°C. RSF1010 Ori; Broad host-range; KanRDepositorArticleInsertsMutL E32K
Lambda Beta
XylS
ExpressionBacterialMutationE32K mutation conferring dominant mutator phenoty…PromoterPmAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
EK0397 3FLAG-ADAR1-p150-HIS (pEAQ)
Plasmid#191172PurposeHuman ADAR1, p150 isoform in plant-expressable format.DepositorAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-C2m2-mKate
Plasmid#208793PurposeFor AAV production to express C2m2-mKate in astrocytesDepositorInsertC2m2-mKate (Mfge8 Mouse)
UseAAVTagsmKateExpressionMammalianMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterGFAP promoterAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pegRNA-GFP>BFP_Y66H-NGG
Plasmid#185480PurposepegRNA plasmid in order to make a Y66H (TAC>CAT) conversion in the GFP gene, creating a BFP gene.DepositorInsertGFP>BFP_Y66H-pegRNA
ExpressionMammalianPromoterU6Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-C2m2-SNAP
Plasmid#208791PurposeFor AAV production to express C2m2-SNAP in astrocytesDepositorInsertC2m2-SNAP (Mfge8 Mouse)
UseAAVTagsSNAP-tagExpressionMammalianMutationMutated 24 and 45 lysine to asparagine in C2 doma…PromoterGFAP promoterAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEZYeGFP-SARS-CoV-2E GGG
Plasmid#224582PurposeTo express a GFP tagged version of the Envelope protein of SARS-CoV-2 with a mutated PBM in mammalian cellsDepositorInsertSARS-CoV-2E GGG (E SARS-CoV-2)
TagsGFPExpressionMammalianMutationPBM (LLV) mutated to GGGPromoterCMVAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1430
Plasmid#29225PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1641
Plasmid#29283PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle170 (POGZ Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 3, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEZYeGFP-SARS-CoV-2E stop
Plasmid#224581PurposeTo express a GFP tagged version of the Envelope protein of SARS-CoV-2 lacking its PBM in mammalian cellsDepositorInsertSARS-CoV-2E stop (E SARS-CoV-2)
TagsGFPExpressionMammalianMutationstop codon before PBMPromoterCMVAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa human
Plasmid#224578PurposeTo stably downregulate the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28 mOct4-POU
Plasmid#206393PurposeExpresses the DNA binding domain of the Oct4 with a 6xHis tag for protein purificationDepositorAvailable SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetO-lox-ERAS
Plasmid#52417PurposeDoxycycline inducible lentiviral vector of human ERAS cDNA with excisable insertDepositorInsertERAS (ERAS Human)
UseLentiviralAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCK302
Plasmid#87768PurposeAs pCK301 (E. coli rhaBAD promoter upstream of sfGFP, sfGFP can be replaced with any gene of interest), but rhaS cloned downstream of ampR, which allows non-metabolisable inducer L-mannose to be usedDepositorInsertsPrhaBAD-sfGFP
rhaS from E. coli with its native RBS from E. coli
UseSynthetic BiologyTags6xHis TagExpressionBacterialPromoterPrhaBAD rhamnose-inducible promoter from E. coli …Available SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only