We narrowed to 4,576 results for: Erf
-
Plasmid#127162Purposeexpression of truncated human cGAS proteinDepositorAvailable SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only
-
GFP-hPIKfyve
Plasmid#121148PurposeExpresses GFP-tagged human PIKfyve in mammalian cells.DepositorInsert1-phosphatidylinositol 3-phosphate 5-kinase isoform 2 (PIKFYVE Human)
TagsGFPExpressionMammalianPromoterCMVAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FRT-Rev-TdTomato
Plasmid#191203PurposeFlpO dependent TdTomato expressionDepositorInsertTdTomato
UseAAVExpressionMammalianPromoterCAGAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE
Plasmid#51509PurposeCan be used to generate AAV virus that will express cytoplasmic tdTomato and presynaptic (synaptophysin-fused) EGFP in the presence of Cre in neurons from the synapsin promoterDepositorHas ServiceAAV1InserttdTomato-T2A-SypEGFP
UseAAVPromoterphSyn1Available SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
EGFP-p300 (D1399Y)
Plasmid#191763PurposeExpression of EGFP fused to catalytically dead core p300 histone acetyltransferase (D1399Y)DepositorInsertFRB-EGFP-p300 core (D1399Y) (EP300 Human)
TagsEGFP (N-terminal of p300 core (D1399Y)) and FRB (…ExpressionBacterial and MammalianMutationcatalytic D1399Y mutation in p300PromoterEF1alphaAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FRT-Rev-3xGFP
Plasmid#191204PurposeFlpO dependent GFP expressionDepositorInsert3X GFP
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7f-WPRE
Plasmid#104488PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the Syn promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV8, and AAV9InsertjGCaMP7f
UseAAVTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterSynapsinAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 NSP3
Plasmid#141257PurposeGateway-compatible Entry vector, with insert of NSP3 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorHas ServiceCloning Grade DNAInsertNSP3 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-ProD1-GCaMP6s
Plasmid#126005PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVPromoterProD1Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ProA1-GCaMP6s
Plasmid#126002PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertGCaMP6s
UseAAVPromoterProA1Available SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
12_pAAV-ProC2-CatCh-GFP-WPRE
Plasmid#125938PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC2Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSicoR p53
Plasmid#12090PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both EGFP and shRNA to be recombined out of the construct, turning OFF p53 shRNA expression.DepositorInsertp53 shRNA (Trp53 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-IRSp53-T2A-Cdc42(G12V)
Plasmid#221329PurposeDox-inducible expression of FLAG-IRSp53-T2A-HA-Cdc42 G12V in mammalian cells by retroviral transductionDepositorUseRetroviralMutationG12VPromoterTRE3GAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FlpO-bGHpA
Plasmid#51669PurposeCan be used to generate AAV virus that will express the FlpO recombinase gene in neurons from the synapsin promoter.DepositorHas ServiceAAV RetrogradeInsertFlpO recombinase gene
UseAAVExpressionMammalianPromoterhSyn1Available SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFB2
Plasmid#195282PurposeBicistronic DTR and Puromycin resistance for positive/negative selectionDepositorAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-CMV-jGCaMP7c variant 1513
Plasmid#105320PurposeMammalian expression of ultrasensitive protein calcium sensorDepositorInsertjGCaMP7c variant 1513
TagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterCMVAvailable SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SARS-CoV-2 NSP5
Plasmid#141259PurposeGateway-compatible Entry vector, with insert of NSP5 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1DepositorHas ServiceCloning Grade DNAInsertNSP5 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1)
UseGateway CloningMutationMany synonymous changes due to codon optimizationAvailable SinceApril 1, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
Fucci(CA) hCdt1-iRFP hGeminin-iRFP
Plasmid#190182PurposeFluorescent reporter vector for visualization of G0 and other cell cycle phases.DepositorInsertsExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-ProC3-Cre/mCherry
Plasmid#126006PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCre-2A-mCherry
UseAAVPromoterProC3Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only