We narrowed to 81,485 results for: MYC;
-
Plasmid#155118PurposeMiddle entry vector containing QFGal4DepositorInsertQFGal4
UseGateway middle entry vectorAvailable SinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT85_P438-mEOS3.2_GentaR
Plasmid#173894PurposeTransposon allowing the expression of the fluorescent protein mEos3.2 in multiple mycoplasma species, under the control of the P438 promoterDepositorInsertmEos3.2
ExpressionBacterialPromoterP438Available SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYC1640
Plasmid#158719PurposeCRISPR system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses Sth1 Cas9 and the cognate sgRNA, using zeocin as a selection marker.DepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-TO-hNGN2-BSD-mApple
Plasmid#182308PurposePiggybac Tet-ON plasmid for differentiating hiPSCs into glutamatergic neurons via NGN2 expression, bsd selection, mAppleInsertsTagsT2A-mycNLS-mAppleExpressionMammalianPromoterEF1a and TRE3GAvailable SinceApril 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28b-His tagged nuclear Pif1
Plasmid#65047Purposeexpression of the nuclear form of Pif1p (Pif1p-delta40), Nterminal His tagDepositorInsertYeast Pif1, nuclear form, N-terminal 6x His-tag (PIF1 Budding Yeast)
TagshistagExpressionBacterialPromoterT7 promoterAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBMN(CMV-copGFP-Puro-SMAR)
Plasmid#80391Purposeexpression copGFP and Puromycine, with an S/MAR element for episomal maintainceDepositorInsertcopGFP-T2A-Puromycine
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pG20_mCherry_TEV_mVenus_Hyg
Plasmid#240653PurposeExpression plasmid for mCherry-TEV-mVenus-tagged proteins with Hygromycin transgenic seed selectionDepositorTypeEmpty backboneTagsmCherry-TEV-mVenusExpressionPlantAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT57
Plasmid#223429PurposeT-DNA vector for dSpCas9 mediated gene activation for dicot plants; NGG PAM; dSpCas9-Act3.0 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-dSpCas9-Act3.0-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3E-FRT-KanR-FRT pA
Plasmid#82601Purpose3' entry vector containing FRT-flanked kanamycin resistance cassette (KanR) with pA for FLP-induced kanamycin resistance, drug selectionDepositorInsertFRT-Kan-FRT
PromoterNoneAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Puro-PECAM1-Neo
Plasmid#201054PurposeEndothelial promoter driven neomycin selection cassetteDepositorInsertAdeno-associated virus integration site 1 (AAVS1 Human)
UseAAVTagsNeomycin resistancePromoterPECAM1Available SinceJuly 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT47
Plasmid#223419PurposeT-DNA vector for Mb2Cas12a-RVRR based mutagenesis for monocot plants; more relaxed PAM requirements; Mb2Cas12a-RVRR and the crRNA were driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-Mb2Cas12a-RVRR-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pGH335_MS2-AID*Δ-Hygro
Plasmid#85406Purposelentiviral expression vector for MS2-AID*Δ fusion protein with hygromycin B selectable markerDepositorInsertMS2-AID*Δ and Hygromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBJ4
Plasmid#167133PurposeA kanamycin resistant plasmid for Tn7-mediated chromosomal integration of Photorhabdus luminescens luxCDABE operon with Pkan promoterDepositorInsertluxCDABE
UseLuciferaseExpressionBacterialPromoterKanamycin promoterAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLPCX roGFP2-Orp1
Plasmid#64991PurposeMammalian expression of cytosolic roGFP2-Orp1 (retroviral vector)DepositorAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
RP1B-PP1alpha
Plasmid#51768PurposeExpresses PP1 alpha residues 7-330DepositorInsertpp1 alpha
TagsHis, TEV protease site, and Thio-6ExpressionBacterialMutationContains PP1 alpha residues 7-330PromoterT7-lacAvailable SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRCC-K
Plasmid#81191PurposeExpression of Cas9 and gRNA cassette in S. cerevisiae; Kan ResistanceDepositorInsertsCas9
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease see depositor comments below. and WT - cod…PromoterROX3 and SNP52pAvailable SinceSept. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMpGE013
Plasmid#108681PurposeAll-in-one genome editing vector in M. polymorpha (hygromycin resistant)DepositorTypeEmpty backboneUseCRISPRAvailable SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET29b-AviTag-mEGFP-dspB(E184Q)-6xHis
Plasmid#176573PurposePlasmid for overexpression of recombinant AviTagged, His-tagged fusion protein mEGFP-DspB(E184Q), used as a fluorescent probe for detection of biofilm polysaccharide PNAG.DepositorInsertDispersin B
TagsAvitag, Hexahistidine tag, and mEGFPExpressionBacterialMutationE184QPromoterT7Available SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT51
Plasmid#223423PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for dicot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-LbCas12a-RRV-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-Cas9-P2A-Puro_BsmBI-sgRNA-BsmBI
Plasmid#188703PurposeLentivirus transfer plasmid encoding Cas9, puromycin resistance, and a BsmBI array for cloning 4 sgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMU-NUCr
Plasmid#61168PurposeFluorescent reporter for nucleus NLS-mCherry-GUS expressed under AtUBQ10 promoterDepositorInsertNLS-mCherry-GUS
ExpressionPlantPromoterAtUBQ10Available SinceFeb. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLPCX mito roGFP2-Orp1
Plasmid#64992PurposeMammalian expression of mitochondrial roGFP2-Orp1 (retroviral vector)DepositorInsertOrp1 (HYR1 Budding Yeast)
UseRetroviralTagsroGFP2ExpressionMammalianMutationmitochondrial targeting sequenceAvailable SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUltra-5HTP
Plasmid#178042PurposeExpress modified ScTrpRS/tRNA for genetic incorporation of 5HTP to TAG codonDepositorInsertsModified ScTrpRS for 5HTP incoporation
suppressor tRNA for 5HTP incorporation
ExpressionBacterialMutationT107C, P254T, C255AAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS158
Plasmid#215679PurposeEmpty repair plasmid for ChrIII split hygromycinR landing padDepositorInsert5'HA + MCS + lox2272 + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT31
Plasmid#223403PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGSKU
Plasmid#72243PurposeContains the CORE cassette with convergent KlURA3 and KanMX4 markers and the I-SceI gene under the inducible GAL1 promoterDepositorInsertsKlURA3
kanMX4
I-SceI
ExpressionBacterialAvailable SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
FRP1642_PTEF-HygMX-TTEF-insul-(lexA-box)4-PminCYC1
Plasmid#58442PurposeCassette to replace yeast promoters with an inducible promoter containing 4 lexA boxesDepositorInsertPTEF-HygMX-TTEF-insul-(lexA-box)4-PminCYC1
ExpressionYeastPromoterPTEF-HygMX-TTEF-insul-(lexA-box)4-PminCYC1Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDN-Sth1Cas9
Plasmid#221386PurposeCas9 under control of AHT inducible TetR on integrating plasmid (KanR) using L5 integrase and attP for site-specific integration into attBDepositorInsertSth1 Cas9
UseCRISPRAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
JD639
Plasmid#160398PurposeBinary vector pGWB14 including miR396-resistant Vitis GRF4-GIF1 under 35S promoter/Plant transformationDepositorInsert35S::vitis miR396-resistant GRF4-GIF1 chimera
UseBinary vectorAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-SP44-sfGFP
Plasmid#163757PurposeExpresses Streptomyces codon-optimised sfGFPDepositorInsertsfGFP
UseSynthetic BiologyTagsNoneExpressionBacterialPromoterSP44Available SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAM-kan-R4R3
Plasmid#71275PurposeBinary destination vector for plant transformation. Kanamycin resistance.DepositorTypeEmpty backboneUseMultisite gatewayAvailable SinceDec. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
JD690
Plasmid#160397PurposeBinary vector pGWB14 including citrus GRF4-GIF1 under 35S promoter/ Plant transformationDepositorInsert35S::citrus GRF4-GIF1 chimera
Promoter35SAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRTC2-puro
Plasmid#190567PurposeExpresses the full-length human L1 (L1.3) retrotransposon and an engineered neomycin retrotransposition reporter to monitor retrotransposition efficiency in cultured mammalian cells.DepositorInsertL1 (L1.3) with reporter cassette
ExpressionMammalianPromoterSV40Available SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-SP44-mScarlet-I
Plasmid#163756PurposeExpresses Streptomyces codon-optimised mScarlet-IDepositorInsertmScarlet-I
UseSynthetic BiologyTagsFlag and FlAsH tagsExpressionBacterialPromoterSP44Available SinceJuly 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZH82 pET28a-Rai1
Plasmid#231651PurposeBacterial expression vector expressing yeast S. cerevisiae rai1, no tagDepositorInsertrai1 (RAI1 Budding Yeast)
ExpressionBacterialAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTopo_Ex2Donor_pPGK-PURO
Plasmid#198862PurposeDonor template for CRISPR/Cas9 targeting of TERT Ex2DepositorInsertPURO
ExpressionMammalianPromoterPGKAvailable SinceMarch 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
JD631
Plasmid#160399PurposeBinary vector pGWB14 including Vitis GRF4-GIF1 under 35S promoter/ Plant transformationDepositorInsert35S::vitis GRF4-GIF1 chimera
UseBinary vectorAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAID6
Plasmid#136989PurposeYeast integration plasmid for expression of dLbCpf1-VP, dSpCas9-RD1152, SaCas9, and Csy4DepositorInsertsdLbCpf1-VP
dSpCas9-RD1152
SaCas9
Csy4
ExpressionYeastPromoterENO2, TDH3, TEF1, and TPI1Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT39
Plasmid#223411PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants select.DepositorInsert2x35s-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-GFP(S65T)-kanMX6
Plasmid#39292DepositorInsertKanR
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Available SinceAug. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pErbB2-ECFP
Plasmid#66945PurposeMammalian expression of rat ErbB2 tagged with ECFPDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pYPQAT45
Plasmid#223417PurposeT-DNA vector for temperature tolerance LbCas12a-D156R based mutagenesis for dicot plants; TTTV PAM; LbCas12a-D156R and the crRNA was driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-LbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-3HA-kanMX6
Plasmid#39295DepositorInsertKanR
UseYeast genomic targetingTags3HA, A. gossypii translation elongation factor 1a…Available SinceSept. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pVDM1001
Plasmid#134660PurposeCRISPR delivery and repair template delivery vectorDepositorInsertCRISPR guide RNA array
ExpressionBacterialAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGH153_MS2-AIDΔ-Hygro
Plasmid#85416Purposelentiviral expression vector for MS2-AIDΔ fusion protein with hygromycin B selectable markerDepositorInsertMS2-AIDΔ and Hygromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only