172,077 results
-
Plasmid#23741DepositorInsertPRKAR1A (PRKAR1A Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCAG/ATP11C-HA
Plasmid#209220PurposeMammalian expression of ATP11CDepositorAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Myc3-CAND1
Plasmid#19948DepositorInsertCAND1 (cullin-associated and neddylation-dissociated 1) (CAND1 Human)
Tagsmyc3ExpressionMammalianAvailable SinceApril 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
pHCAG-L2EOP
Plasmid#51783PurposeThe oriP/EBV nuclear antigen (EBNA)-1 elements of Epstein-Barr virus is fused in frame with the luciferase in the herpes simplex virus type-1 amplicon vector, provides prolonged transgene expressionDepositorInsertsLuciferase-2A-EBNA-1
OriP
UseHerpes simplex virus type-1 amplicon vectorPromoterCAGAvailable SinceJune 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
EF1a- gfp-2a-puro
Plasmid#129443Purposeexpression of GFP and Puro RDepositorInsertgfp-puro
UseLentiviralAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
LiOn-CMV∞Cre
Plasmid#154018PurposeVector based on the LiOn integration-coupled translational switch (Kumamoto et al bioRxiv 2019) expressing a functional Cre recombinase from a CMV promoter upon action of the piggyBac transposaseDepositorInsertCre-FLAG
ExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A-HAUS6_IRES_Blast
Plasmid#182886PurposeTransfer vector for production of lentivirus. Expresses EGFP-P2A-HAUS6 (WT full length)DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralTagsEGFPExpressionBacterial and MammalianPromoterEF1alpha coreAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LRP4-Flag/pCDNA3.1
Plasmid#197291PurposePlasmid expressing an antigen targeting LRP4 (extracellular)DepositorAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti 4.1 Ex miR200c-141
Plasmid#35534Purpose3rd generation lentiviral vectorDepositorUseLentiviralTagsGFPExpressionMammalianPromoterCMVAvailable SinceApril 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAW014-2
Plasmid#85612PurposeMulti-gRNA delivery vector containing ugtP-gRNA.P395T for Bacillus subtilisDepositorInsertugtP-gRNA.P395T
ExpressionBacterialAvailable SinceJan. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
M31: pHR-SFFVp- TDP-43C::mCherry::SspB
Plasmid#122669PurposeC terminal domain of TDP43 (218-414) tagged with SspB and mCherry.DepositorInsertTDP43 (TARDBP Human)
UseLentiviralTagsmCherry-SspBExpressionMammalianMutationContains only amino acids 218-414PromoterSFFVAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKC152_Lenti_tetoff_PABP-INT_EF1a_EGFP
Plasmid#250950PurposeA lentiviral vector express PABP-INT fusion protein under a Tetoff system. Contains EGFP as selection marker.DepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cre-P2A-dTomato (AAV PHP.eB)
Viral Prep#107738-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-hSyn-Cre-P2A-dTomato (#107738). In addition to the viral particles, you will also receive purified pAAV-hSyn-Cre-P2A-dTomato plasmid DNA. hSyn-driven expression of Cre and dTomato (physically separate). These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsdTomato (physically separate, not a fusion protein)Available SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST26-PPP2CB-C-HA
Plasmid#195179PurposeVector for transient expression of PPP2CB gene with C-terminal HA tag, gene flanked by att sites for gateway cloningDepositorAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-SLC7A6_STOP
Plasmid#161375PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors. Contains a STOP codon at the end of the codon-optimized ORF sequence.DepositorInsertSLC7A6 (SLC7A6 Human)
ExpressionMammalianAvailable SinceSept. 15, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
TFORF2102
Plasmid#141923PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-DreO-bGHpA
Plasmid#50363PurposeCan be used to generate AAV virus that will express DreO recombinase in neurons from the synapsin promoterDepositorHas ServiceAAV Retrograde and AAV5InsertDreO recombinase
UseAAVTagsnoneMutationSequence optimized for expression in mammalian ce…PromoterhSyn1Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
Amph1-pmCherryN1
Plasmid#27692DepositorAvailable SinceMay 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
V48 ELP
Plasmid#68395PurposeElastin-like polypeptide (VPGxG) with 48 repeats of valine guest residueDepositorInsertV48 ELP
ExpressionBacterialPromoterT7Available SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only