We narrowed to 27,413 results for: CAT
-
Plasmid#202150PurposeLevel 0 plasmid containing an origin of transfer sequence from pPtPBR11 required for making plasmids mobilizable for conjugation with CE overhangs used to build level 1 constructs.DepositorInsertOrigin of transfer
UseSynthetic BiologyMutationOriT sequence mutated to remove sapI sites domest…Available SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-Fld
Plasmid#202125PurposeLevel 0 plasmid containing the promoter from gene 23658 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertFld promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-54730
Plasmid#202109PurposeLevel 0 plasmid containing the promoter from gene 54730 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert54730 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-51183
Plasmid#202108PurposeLevel 0 plasmid containing the promoter from gene 51183 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert51183 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-GEF
Plasmid#202107PurposeLevel 0 plasmid containing the promoter from gene 41365 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertGEF promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-47740
Plasmid#202106PurposeLevel 0 plasmid containing the promoter from gene 47740 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert47740 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-BCA
Plasmid#202105PurposeLevel 0 plasmid containing the promoter from gene 51305 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertBCA promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-epyC
Plasmid#202104PurposeLevel 0 plasmid containing the promoter from gene 41316 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertepyC promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV_tKiMBImut-T2A-caMEK
Plasmid#199579PurposeExpress tKiMBImut(AA) and caMEK in an AAV vectorDepositorInsertsERK tdTomato-Kinase-Modulated Bioluminescent Indicator (mutant)
constitutively active MEK
UseAAVExpressionMammalianPromoterCMVAvailable SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRA1SEGFPTcIfm
Plasmid#193777PurposeCassette 1: Expresses EGFP under the control of PR promoter, Cassette 2: Expresses frame-shifted CI under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertEGFP and frame-shifted CI in opposite orientation, controlled by separate promoters and terminators
UseSynthetic BiologyExpressionBacterialPromoterPR promoter and PLTetO-1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgCebpa_v2-hu6-sgCebpd_v2
Plasmid#177254PurposeExpresses Cebpa_v2 (mU6), Cebpd_v2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v2/sgCebpd_v2
UseLentiviralPromotermU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEPQDKN0760
Plasmid#185629PurposeModified tobacco rattle virus RNA2 vector expressing an sgRNA fused to trucated flowering locus T (BsaI-domesticated) which targets phytoene desaturase (PDS) of Nicotiana benthamianaDepositorInsertsgRNA
UseCRISPR and Synthetic BiologyAvailable SinceAug. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBtPIPLC_N168C His
Plasmid#173809PurposeExpression and purification of the mature form of Bacillus thuringiensis phosphaatidyl inositol specific phospholipase C (PI-PLC), UniProt ID P08954 from E. coli BL21 CodonPlus (DE3) RIL cellsDepositorInsertBacillus thuringiensis 1-phosphatidylinositol phosphodiesterase
Tags6XHisExpressionBacterialMutationAsn168Cys for labelingPromoterT7Available SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
GSX2-P2A-tGFP-DTA
Plasmid#161750PurposetGFP plasmid for the c-terminal targeting of human GSX2 locusDepositorInsertturboGFP
UseCRISPRTagsP2A-tGFPExpressionMammalianPromoterendogenous GSX2 promoterAvailable SinceDec. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCIS-rPALcc
Plasmid#145804Purposeexpresses the catalytic core of rat peptidyl-hydroxyglycine-alpha-amidating lyase in mammalian cellsDepositorInsertrat PALcc (peptidyl-hydroxyglycine alpha-amidating monooxygenase) (Pam Rat)
ExpressionMammalianMutationchanged serine 767 to alanine to prevent glycosyl…PromoterCMVAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3 FLAG_CMV14/OCTN2 (delta554_557/PDZ)
Plasmid#112803PurposeExpression of OCTN2 mutantDepositorInsertOCTN2/SLC22A5 (Slc22a5 Rat)
Tags3 x FlagExpressionMammalianMutationamino acids 554_557 deleted/PDZAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
p3 FLAG_CMV14/OCTN2 (delta14_22)
Plasmid#112800PurposeExpression of OCTN2 mutantDepositorInsertOCTN2/SLC22A5 (Slc22a5 Rat)
Tags3 x FlagExpressionMammalianMutationamino acids 14_22 deletedAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P-1 BICC FL
Plasmid#112998PurposeFor protein expression and purification of full-length Drosophila BicCDepositorInsertfull length BicC (BicC Fly)
ExpressionBacterialAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only