We narrowed to 3,362 results for: cat.3
-
Plasmid#184840PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the mRNA of deGFP and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the the mRNA of deGFP, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-mTDGa.1
Plasmid#81051Purposebacterial expression of catalytically dead murine TDGDepositorInsertTDG (Tdg Mouse)
Tags6HISExpressionBacterialMutationasparagine 151 changed to alaninePromoterT7Available SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTG-mTDGa.1
Plasmid#81049Purposebacterial expression of catalytically dead murine TDGDepositorInsertTDG (Tdg Mouse)
TagsGSTExpressionBacterialMutationasparagine 151 changed to alaninePromoterT7Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
YCe2741 HC_Kan_EF1ap_p18
Plasmid#100698Purposepart designed to occupy position 18 of EMMA. Functional category: Constitutional promoterDepositorInsertEF1a promoter (EEF1A1 Human)
UseSynthetic BiologyAvailable SinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
H3S10ph biosensor
Plasmid#120809PurposeFRET biosensor. To monitor histone H3 Serine 10 phosphorylation in mammalian cells by FRETDepositorInsertMouse histone H3-CFP-FHA2-histone H3 peptide (1-14aa)-YFP
ExpressionMammalianMutationThreonine 3, Threonine 6, and Threonine 11 are mu…PromoterCMVAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3-hALDOA D34S
Plasmid#210810PurposeTo reduce the catalytic constant (kcat) for conversion of FBP to dihydroxyacetone phosphate (DHAP) and glyceraldehyde-3-phosphate (G3P)DepositorInsertALDOA (ALDOA Human)
TagsHAExpressionMammalianMutationresidues 34 of ALDOA mutated to serinePromoterCMVAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAdEasy-hALDOA D34S
Plasmid#210813PurposeTo reduce the catalytic constant (kcat) for conversion of FBP to dihydroxyacetone phosphate (DHAP) and glyceraldehyde-3-phosphate (G3P)DepositorInsertALDOA (ALDOA Human)
UseAdenoviralTagsHAMutationresidues 34 of ALDOA mutated to serinePromoterCMVAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBoBi-hALDOA D34S
Plasmid#210807PurposeTo reduce the catalytic constant (kcat) for conversion of FBP to dihydroxyacetone phosphate (DHAP) and glyceraldehyde-3-phosphate (G3P)DepositorInsertALDOA (ALDOA Human)
UseLentiviralTagsHAMutationresidues 34 of ALDOA mutated to serinePromoterCMVAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
p-miR-Report + WT miR-181 BS in GATA6 3UTR
Plasmid#22794DepositorInsertWild-type miR-181 Binding Site in GATA binding protein 6 3 Untranslated Region (GATA6 Human)
UseLuciferaseAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
p-miR-Report + MT miR-181 BS in GATA6 3UTR
Plasmid#22795DepositorInsertMutant miR-181 Binding Site in GATA binding protein 6 3 Untranslated Region (GATA6 Human)
UseLuciferaseAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only -
pPB CAG SMARCA4-Venus
Plasmid#153950PurposepiggyBac transposon vector with CAG promoter expressing SMARCA4-Venus fusion proteinDepositorAvailable SinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-NR5A1-deltaLBD-FLAG
Plasmid#242228PurposeExpression of human SF-1 ∆LBD (deletion of a.a. 221-459) using piggyBac transpositionDepositorInsertNR5A1 (NR5A1 Human)
UsePiggybacTagsFLAGExpressionMammalianMutationDeleted ligand binding domain (LBD) from SF-1 (de…PromoterCAGAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSico shMAP3K2 human
Plasmid#85656Purposeexpression of shRNA targeting human MAP3K2DepositorInsertshRNA targeting 3'UTR of MAP3K2 (MAP3K2 Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDF-MCM4/6
Plasmid#116951PurposeExpresses human MCM4 and human MCM6DepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB CAG SMARCA4-IRES-EGFP
Plasmid#153948PurposepiggyBac transposon vector with CAG promoter expressing wild-type SMARCA4 (FLAG-tagged) and EGFPDepositorAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-ARID1A-FLAG
Plasmid#242209PurposeExpression of full-length human ARID1A using piggyBac transpositionDepositorAvailable SinceSept. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET32-MCM2/7
Plasmid#116949PurposeExpresses human MCM2 and human MCM7DepositorAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZE21/UBP1/ClpS_V65I
Plasmid#98567PurposeExpresses truncated codon-opt S. cerevisiae UBP1 and the V65I engineered variant of E. coli ClpS in an artificial operonDepositorInsertsTruncated ubiquitin cleavase, codon optimized
Mutated ATP-dependent Clp protease adapter protein
ExpressionBacterialMutationContains the V65I mutation that increases discrim…Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only