We narrowed to 18,344 results for: multi
-
Plasmid#55643PurposevCre-Dependent ChR2-EYFPDepositorInserthChR2(H134R)-EYFP
UseAAV; Vcre-dependent chr2-eyfpTagsEYFPExpressionMammalianPromoterEf1aAvailable sinceAug. 8, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP
Plasmid#62348PurposeAn empty optimized gRNA expression vectorDepositorInsertnone
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR_Gal4UAS_Blinatumomab_PGK_mCherry
Plasmid#85437Purpose[Edit] Lentiviral vector for Gal4 inducible Blinatumomab and constitutive mCherry expressionDepositorInsertBlinatumomab
UseLentiviralExpressionMammalianAvailable sinceNov. 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
6xHis-SNAP-PI(4,5)P2 Probe
Plasmid#211513PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-4,5-Bisphosphate (PI(4,5)P2) from bacteriaDepositorInsertPLCdelta1-PH
Tags6xhis-SNAPExpressionBacterialAvailable sinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ExRai-CKAR
Plasmid#118409PurposecpGFP-based excitation-ratiometric biosensor for monitoring Protein Kinase C activity.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertExRai-CKAR
Tags6xHIS, T7 tag (gene 10 leader), and Xpress (TM) t…ExpressionMammalianPromoterCMVAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYLCRISPR/Cas9P35S-H
Plasmid#66189Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), hygro selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available sinceJune 4, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pINDUCER-21-RUNX1-P2A-ERG
Plasmid#97045PurposeExpresses RUNX1-P2A-ERG in mammalian cells. *Please see notes below on P2A cleaving efficiency.DepositorInsertRunt Related Transcription Factor 1, ETS-Related Gene
UseLentiviralExpressionMammalianPromoterTet onAvailable sinceSept. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-stop-FRT3-FRT-FRT3-Gal4 attB
Plasmid#52889Purpose"CoinFLP-Gal4" - Expresses Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express Gal4, or FRT3-FRT3 pair to prevent Gal4 expressionDepositorInsertGal4 (GAL4 Budding Yeast)
ExpressionInsectAvailable sinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOPINB-AMSH*
Plasmid#66712PurposeExpresses activated AMSH in E. coliDepositorAvailable sinceJuly 17, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMAH-POLY
Plasmid#64915PurposeEncodes a polyspecific aminoacyl-tRNA synthetase and four copies of amber suppression tRNAs for unnatural amino acid incorporation in mammalian cellsDepositorInsertsPolyspecific aminoacyl-tRNA Synthetase
Amber Suppression tRNA
TagsNoneExpressionMammalianPromoterCMV and U6/H1Available sinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJFRC160-21XUAS-B3RT>-dSTOP-B3RT>-myr::RFP
Plasmid#32139DepositorPublicationInsertB3RT> STOP STOP B3RT>
ExpressionInsectAvailable sinceNov. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCas9cur
Plasmid#71538PurposeConstitutive expression of Cas9 gene and inducible expression of the plasmid curing system for CRISPR mediated genome editing of E. coli.DepositorInsertsCas9
Plasmid curing system
UseCRISPRExpressionBacterialPromoterpBADAvailable sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-link-yoEGFP-SpHis5
Plasmid#44836PurposeYeast tagging vector to create gene fusion with yeast optimized EGFP with SpHis5 selectionDepositorInsertyoEGFP
ExpressionYeastAvailable sinceMay 9, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCVL.SFFV.d14GFP.EF1a.HA.NLS.Sce(opt).T2A.TagBFP
Plasmid#32627DepositorInsertDonor + Sce BFP
UseLentiviralAvailable sinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGG-9.47_VP1,3 #2515
Plasmid#74237PurposeModified plasmid with a different backbone that yields higher of AAV-AS vectors. Encodes VP1 and VP3 of AAV9.47DepositorInsertsAAV2 Rep
AAV9.47 VP1
AAV9.47 VP3
UseAAVAvailable sinceApril 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTwist-Kan-HC-L0-TaMOFB1(int)
Plasmid#242005PurposeL0 CDS1 Golden Gate part of the pre-mRNA (excluding UTRs) of Triticum aestivum MORE FLORET 1 (MOF-1) / MULTI-FLORET SPIKELET 2 (MFS-2) B-subgenome homoeolog (TraesCS2B02G420900)DepositorInsertTaMOF-B1_with_introns
UseSynthetic BiologyExpressionPlantAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
4xNLS-pMJ915v2-sfGFP
Plasmid#88921PurposeFor expression of modified SpyCas9 in e.coli.DepositorInsertsCas9
T7
UseCRISPRExpressionBacterialAvailable sinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTiger-OptoSOS
Plasmid#86439PurposeSingle-construct blue light optogenetic Ras activator for use in DrosophilaDepositorInsertOptoSOS
TagstagRFPExpressionInsectPromoterGal4-UASAvailable sinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PVS10
Plasmid#104398Purposepolycistronic vector for expression of E. coli core RNAPDepositorTagsHis6ExpressionBacterialPromoterT7Available sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by