We narrowed to 8,402 results for: 221
-
Plasmid#120353PurposepiggyBac transposon for dox-inducible expression of the OKMS (Oct4, Klf4[10-483], c-Myc, Sox2) polycistronic reprogramming cassette (with mCherry). SpCas9 is constitutively expressed.DepositorInsertOKMS cassette
UseCRISPR; Piggybac transposonExpressionMammalianMutationKlf4 [10-483]Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2441 - [1-2] ENTR - Fluor - ce-Dendra2(PATCs(900bp), NLS, no_atg, no stop)
Plasmid#159870PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-Dendra2(PATCs(900bp), NLS, no_atg, no stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX458-sgRNA_Ago2_3
Plasmid#73531PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago2DepositorInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pX458-sgRNA_Ago2_4
Plasmid#73532PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago2DepositorInsertAGO2
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV Reep4-V5
Plasmid#175120PurposeLentiviral expression of mouse Reep4-V5DepositorAvailable SinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
IX301: pMVP (L3-L2) myc epitope tag + polyA
Plasmid#121753PurposepMVP L3-L2 entry plasmid, contains myc epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertmyc epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2443 - [1-2] ENTR - Fluor - ce-mMaple3(PATCs(900bp), NLS, no_atg, no stop)
Plasmid#159867PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-mMaple3(PATCs(900bp), NLS, no_atg, no stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_MED13_iso1
Plasmid#135733PurposeDonor vector for 3' FLAG tag of human MED13_iso1DepositorAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2309 - [1-2] ENTR - Fluor - mCardinal(1 intron, syntrons(3), NLS(2), no_atg, no_stop)
Plasmid#159861PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mCardinal(1 intron, syntrons(3), NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
IX601: pMVP (L3-L2) FLAG epitope tag + polyA
Plasmid#121751PurposepMVP L3-L2 entry plasmid, contains FLAG epitope tag + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest.DepositorInsertFLAG epitope tag + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRB113.2
Plasmid#181948PurposeaTc-inducible expression of NarL with C-terminal mNeonGreen fusion. Also contains mCherry under NarL-controlled promoter PdcuSDepositorInsertTagsmNeonGreenExpressionBacterialPromoterNarL-mNG-PLtetO-1; mCherry-PdcuS; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
KZ401: pMVP (L3-L2) P2A-Neo + polyA
Plasmid#121781PurposepMVP L3-L2 entry plasmid, contains Neo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Neo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Neo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_DUM1H01
Plasmid#71090PurposeGateway entry cloneDepositorInsertnej (nej Fly)
UseGateway entry vectorAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ601: pMVP (L3-L2) P2A-Zeo + polyA
Plasmid#121783PurposepMVP L3-L2 entry plasmid, contains Zeo-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Zeo selection marker linked by P2A to gene of interest.DepositorInsertP2A-Zeo + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pLV V5-nurim
Plasmid#175110PurposeLentiviral expression of V5-tagged mouse NrmDepositorAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dicer_3
Plasmid#68809Purposespecific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation of Dicer1 knockout mESCs.DepositorInsertsgRNA mouse Dicer1
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJW1820
Plasmid#154321PurposeMulti-cassette for SapTrapDepositorInsertGFP^SEC (LoxP)^AID*::3xFLAG
UseCRISPR and Cre/LoxExpressionWormAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
KZ001: pMVP (L3-L2) P2A-eYFP + polyA
Plasmid#121770PurposepMVP L3-L2 entry plasmid, contains eYFP-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eYFP linked by P2A to gene of interest.DepositorInsertP2A-eYFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
LA601: pMVP (L3-L2) P2A-Puro + WPRE
Plasmid#121785PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to a gene in lentivirus vectorsDepositorInsertP2A-Puro + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO401: pMAGIC (R4-R3) NLS-x Cas9(3.7)-NLS
Plasmid#121834PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS xCas9(3.7) (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-Cas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KY901: pMVP (L3-L2) P2A-mCherry + polyA
Plasmid#121766PurposepMVP L3-L2 entry plasmid, contains mCherry-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term mCherry linked by P2A to gene of interest.DepositorInsertP2A-mCherry + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
2XMyc-LRRK2-RCK-Y1699C
Plasmid#25067DepositorInsertLRRK2 (LRRK2 Human)
Tags2XMycExpressionMammalianMutationContains only the ROC-COR-Kinase domains aa 1329…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
KZ501: pMVP (L3-L2) P2A-Puro + polyA
Plasmid#121780PurposepMVP L3-L2 entry plasmid, contains Puro-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term Puro selection marker linked by P2A to gene of interest.DepositorInsertP2A-Puro + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Dicer_2
Plasmid#68808Purposespecific sgRNA against mouse Dicer1 gene cloned in the pX330 backbone (Addgene Number 42230). Generation ofDepositorInsertsgRNA mouse Dicer1
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable SinceFeb. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX330_MED13_iso1_1
Plasmid#135751PurposeEncodes gRNA for 3' target of human MED13_iso1DepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
IA201: pMAGIC (R4-R3) NLS-Sa dCas9-NLS
Plasmid#121821PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 (nuclease-dead) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KHBD00638
Plasmid#39705DepositorAvailable SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
KA501: pMVP (L3-L2) pA; CMV::TETa-pA
Plasmid#121801PurposepMVP L3-L2 entry plasmid, contains polyA + CMV-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds CMV-driven TETa downstream of gene of interest.DepositorInsertpolyA + CMV::TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
HD201: pMVP (L3-L2) IRES-eGFP + polyA
Plasmid#121747PurposepMVP L3-L2 entry plasmid, contains IRES2-eGFP+ polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of eGFP reporter from IRES sequence.DepositorInsertIRES2-eGFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KHBD00732
Plasmid#39749DepositorAvailable SinceAug. 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
LA201: pMVP (L3-L2) P2A-eCFP + WPRE
Plasmid#121776PurposepMVP L3-L2 entry plasmid, contains eCFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eCFP linked by P2A to gene of interest.DepositorInsertP2A-eCFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA001: pMVP (L3-L2) P2A-mCherry + WPRE
Plasmid#121774PurposepMVP L3-L2 entry plasmid, contains mCherry-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term mCherry linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-mCherry + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2453 - [1-2] ENTR - Fluor - ce-mCardinal(900bp PATCs, NLS, no_atg, no_stop)
Plasmid#159863PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-mCardinal(900bp PATCs, NLS, no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pX458-sgRNA_Ago1_3
Plasmid#73535PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1DepositorInsertAGO1
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
KN701: pMAGIC (R4-R3) NLS-x dCas9(3.7)-NLS
Plasmid#121828PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS x-dCas9(3.7) (nuclease-dead) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertx-dCas9(3.7) (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KO701: pMVP (L3-L2) HA tag + pA; EF1a::TETa-pA
Plasmid#121806PurposepMVP L3-L2 entry plasmid, contains HA tag-polyA + EF1a-TETa-polyA for 3- or 4-component MultiSite Gateway Pro assembly. Adds C-term HA tag to gene plus downstream EF1a-driven TETaDepositorInsertHA epitope tag-polyA + EF1a::TETa-polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KH001: pMVP (L3-L2) V5 epitope tag + WPRE
Plasmid#121762PurposepMVP L3-L2 entry plasmid, contains V5 epitope tag + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term epitope fusion to a gene of interest in lentivirus vectors.DepositorInsertV5 epitope tag + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2306 - [1-2] ENTR - Fluor - ceGFP(1 intron, syntrons(3), NLS(2), no_atg, no_stop)
Plasmid#159848PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ceGFP(1 intron, syntrons(3), NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFJ2307 - [1-2] ENTR - Fluor - ce-tagRFP-T(1 intron, syntrons(3), NLS(2), no_atg, no_stop)
Plasmid#159856PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - ce-tagRFP-T(1 intron, syntrons(3), NLS(2), no_atg, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
2XMyc-LRRK2-RCK-K1347A
Plasmid#25066DepositorInsertLRRK2 (LRRK2 Human)
Tags2XMycExpressionMammalianMutationContains only the ROC-COR-Kinase domains aa 1329…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJW1806
Plasmid#154319PurposeNT Donor-cassette for SapTrapDepositorInsertlinker::3xMyc for NT slot
UseCRISPRExpressionWormAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only