167,514 results
-
Plasmid#140464PurposeRed fluorescent indicator for calcium imaging in the mitochondria (low affinity variant)DepositorInsertR-CEPIA3mt
TagsMycExpressionMammalianAvailable SinceMay 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOS007: PercevalHR ATP/ADP sensor (cytosolic)
Plasmid#163061PurposePercevalHR ATP/ADP sensor (cytosolic)DepositorInsertPercevalHR
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (AAV9)
Viral Prep#104492-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (#104492). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7f-WPRE plasmid DNA. Syn-driven, Cre-dependent GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 GFP
Plasmid#10676PurposeRetroviral shRNA vector. Derivative of pMKO.1 puro (Addgene plasmid #8452) with GFP instead of puromycin resistance gene.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseRNAi and RetroviralExpressionMammalianAvailable SinceDec. 7, 2005AvailabilityAcademic Institutions and Nonprofits only -
R777-E172 Hs.PIK3R1-nostop
Plasmid#70456PurposeGateway ORF clone of human PIK3R1 [NM_181523.2] without stop codon (for C-terminal fusions)DepositorInsertPIK3R1 (PIK3R1 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-eNpHR 3.0-EYFP (AAV5)
Viral Prep#26972-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSyn-eNpHR 3.0-EYFP (#26972). In addition to the viral particles, you will also receive purified pAAV-hSyn-eNpHR 3.0-EYFP plasmid DNA. hSyn-driven eNpHR 3.0-EYFP for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEYFPAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMRE-Tn5-145
Plasmid#118529PurposeminiTn5 plasmid to deliver constitutively expressed fluorescent protein genes in bacteriaDepositorInsertmScarlet-I
UseMinitn5 delivery vectorExpressionBacterialAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ubiquitin WT
Plasmid#12647DepositorAvailable SinceJuly 31, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Flag beta-2-adrenergic-receptor
Plasmid#14697DepositorAvailable SinceJune 19, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAW12.lentiguide.GFP
Plasmid#104374PurposeGFP vector for cloning in guidesDepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
EF.STAT3C.Ubc.GFP
Plasmid#24983Purpose3rd generation lentiviral expression of constitutively active Stat3DepositorInsertSTAT3 (STAT3 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationA662C, N664C (constitutively active)Available SinceMay 28, 2010AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Cas9-2A-BFP
Plasmid#164662PurposeRetroviral introduction of Cas9 into mammalian cell line coupled to expression of blue fluorescent proteinDepositorInsertsCas9
BFP
UseCRISPR and RetroviralExpressionMammalianPromoterMSSV_LTRAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ERBB3
Plasmid#116735PurposeLentiviral expression of ERBB3DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGDP1 NDM-1
Plasmid#112883PurposeThis plasmid is part of the Minimal Antibiotic Resistance Platform (ARP) Kit (Addgene #1000000143). Low copy-number plasmid that constitutively expresses genes using the Pbla promoter.DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMA4008
Plasmid#70109PurposemtDNA destruction/production of rho-0 cellsDepositorInsertsEGFP
Herpes simplex virus UL12.5M185
TagsnoneExpressionMammalianMutationN-terminal deletion of UL12.5PromoterCMV and RSVAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-mNG-IRES-mScarlet-dMCP
Plasmid#231089PurposeBicistronic construct encoding mNG in combination with mScarlet-dMCP via an EMCV-IRES sequence.DepositorInsertmNG-IRES-mScarlet-dMCP
ExpressionMammalianAvailable SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-HA-ER WT
Plasmid#49498PurposeExpresses HA-tagged ER wild-type in mammalian cellsDepositorAvailable SinceDec. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCXB-EBNA1
Plasmid#41857DepositorAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
Escherichia coli DH10B-MOB
Bacterial Strain#229395PurposeEscherichia coli DH10B DAP-auxotrophic strain containing an integrated RK2/RP4 mobilization vector to conjugate plasmids with an IncP origin of transfer (modified pTA-Mob 2.0, AddGene Plasmid #149662)DepositorBacterial Resistance60 ug/ml of dapSpeciesEscherichia coliAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Dnmt3a3lCD
Plasmid#235576PurposeDox-inducible expression of the catalytic-domain (CD) of epigenetic effector Dnmt3a3L fused with scFV to programme DNA methylationDepositorAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Rab7A Q67L
Plasmid#28049DepositorAvailable SinceMay 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPGK-SB13
Plasmid#236078PurposeSB13 transposase, for use with Sleeping Beauty transponson plasmidsDepositorInsertSB13 transposase
UseSleeping beauty (sb) transposase plasmidPromoterPGKAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcsII-pb5-flag
Plasmid#86769PurposeC-terminal flag-tagged protein expression in mammalian cells, lentiviral vectorDepositorInsertproteasome beta subunit 5 (PSMB5 Human)
UseLentiviralTagsflagExpressionMammalianPromoterEF-1aAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-mCherry (AAV5)
Viral Prep#114469-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CaMKIIa-mCherry (#114469). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-mCherry plasmid DNA. CamKIIa-driven expression of mCherry. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsmCherryAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-hSyn1-GFP
Plasmid#177810PurposeEncodes a GFP driven by human synapsin I promoterDepositorInsertCopGFP inserted behind human synapsin I promoter (SYN1 Human)
UseLentiviralExpressionMammalianPromoterSyn1Available SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-FLEx-axon-GCaMP6s (AAV5)
Viral Prep#112010-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSynapsin1-FLEx-axon-GCaMP6s (#112010). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-FLEx-axon-GCaMP6s plasmid DNA. Synapsin-driven, cre-dependent axon targeted GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 Connexin43-GFP-APEX2
Plasmid#49385PurposeExpresses a tandem GFP-APEX2 fusion to the C-terminus of connexin43 in mammalian cellsDepositorInsertConnexin43 - EGFP - APEX2
ExpressionMammalianMutationK14D, W41F, E112K, A134P on soybean APX; improved…PromoterCMVAvailable SinceNov. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDAC565
Plasmid#195242PurposeMammalian expression of Csm-GFP complex (RNase mut) from separate promoters (Used for RNA imaging)DepositorInsertFLAG-NLS-Csm1; FLAG-NLS-Csm2, FLAG-NLS-Csm3(RNase mut)-GFP; FLAG-NLS-Csm4; FLAG-NLS-Csm5; FLAG-NLS-Cas6; crRNA
ExpressionMammalianAvailable SinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only