We narrowed to 19,577 results for: MUT
-
Plasmid#89745PurposeExpression of light-regulated JNK inhibitor, firefly luciferase-fused, dark-state mutant photosensor (AsLov2Ja.C450A), inhibitor JIP11DepositorInsertOptoJNKi dark-state mutant
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationC450A mutation of AsLov2JalphaPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMDC43-FIT2-N[80]A
Plasmid#96995PurposeExpress GFP-tagged mutated mouse FIT2 gene in plants.DepositorInsertMmFIT2 (Fitm2 Mouse)
TagsGFPExpressionPlantMutationAmino acid residue 80 was mutated (N[80]A). Mutat…Promoter35SAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-NSF/T646A
Plasmid#74937PurposeMammalian expression of human NSF mutant T646A (mutation in the D2 domain of the protein)DepositorInsertNSF (NSF Human)
TagsFLAGExpressionMammalianMutationT646A (mutation in the D2 domain of the protein)PromoterCMVAvailable SinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hSOX10-G1238A-C1240T
Plasmid#24739DepositorInsert(sex determining region Y)-box 10 (SOX10 Human)
UseGateway donor vectorMutationG replaced with A at position 1238 and C replaced…Available SinceMay 18, 2010AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-FHC-POLQ-DY2230AA
Plasmid#64878Purposelentiviral expression of human POLQ -DY2230AA mutant (a polymerase domain mutant)DepositorInsertPOLQ (POLQ Human)
UseLentiviralTagsFLAG and HAExpressionMammalianMutationD2330A,Y2331A, in the DNA polymerase domain (POL)…PromoterEF1alphaAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/FGFR2-S252W(Apert) myc
Plasmid#33249DepositorInsertFGFR2 (Fgfr2 Mouse)
TagsHis and MycExpressionMammalianMutationMutation S252W in FGFR2 found in Apert syndrome. …PromoterCMVAvailable SinceDec. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-TOP3B (Y336F)-3xFLAG
Plasmid#249682PurposeExpresses human TOP3B (Y336F; catalytically inactive mutant) with a C-terminal 3xFLAG tag in mammalian cellsDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-TOP3B (R338W)-3xFLAG
Plasmid#249683PurposeExpresses human TOP3B (R338W; "self-trapping" mutant) with a C-terminal 3xFLAG tag in mammalian cellsDepositorAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
LV-AR-AAFF
Plasmid#171218PurposeLenti-viral expression of human androgen receptor DNA-binding mutant: K580A-V581A, mutations in the P-box of the zinc finger 1 at the KVFF motif.DepositorInsertAR-AAFF (AR Human)
UseLentiviralTagsFlagExpressionMammalianMutationAR-K580A-V581APromoterEF-1aAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
AID-C12*-dCas9-BE4max
Plasmid#216731PurposeExpresses a BE4max base editing construct comprised of the hyperactive AID-C12* and dCas9 (Cas9 with D10A and H840A mutations) in mammalian cells.DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 asyn G51D
Plasmid#105747PurposeBacterial expression of mutant human alpha synucleinDepositorAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)_4x(U6 tRNA M15)_CMV NESPylRS(AF)
Plasmid#182652PurposeEncodes codon-optimized AF mutant of M. mazei pyrrolysine (Pyl) tRNA synthetase fused to a nuclear export signal (NESPylRSAF) & 4x M15 tRNACUA used for amber codon suppression in mammalian cellsDepositorInsertscodon-optimized Y306A/Y384F (AF) double mutant of Methanosarcina mazei-derived pyrrolysine (Pyl) tRNA synthetase
4xU6-tRNAM15
Tagsnuclear export signal (NES)ExpressionMammalianMutationY306A/Y384F (AF) double mutant of Methanosarcina …PromoterCMV and U6Available SinceMay 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1a_Flag_TP53_R248W
Plasmid#183114PurposeExpresses flag-tagged p53 with R248W mutation in mammalian cellsDepositorInsertTP53 (TP53 Human)
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationchanged arginine 248 to tryptophanPromoterEF1aAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-IDH2-R172K
Plasmid#87927PurposeExpresses IDH2 (R172K mutant) in mammalian cellsDepositorInsertisocitrate dehydrogenase (NADP(+)) 2, mitochondrial (IDH2 Human)
TagsnoneExpressionMammalianMutationR172KPromoterCMVAvailable SinceJune 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-P301L Tau
Plasmid#176267PurposeThis AAV plasmid vector expresses human 2N4R microtubule-associated protein tau with P301L mutation.DepositorAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBOB-CAG-SARS-CoV2-Spike D614G-HA
Plasmid#158761Purpose3rd Generation lentiviral vector expressing the codon optimized SARS-CoV2 Spike Glycoprotein D614G high infectivity mutant with a C-terminal HA tag generated by Junko Ogawa & Gerald M PaoDepositorInsertSARS-CoV2 Spike Glycoprotein (S SARS-CoV2 hCoV19_USA EPI_ISL_414366 (GISAID))
UseLentiviralTagsHAExpressionMammalianMutationSpike D614GPromoterCAGAvailable SinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-HA-NEK7 K64M
Plasmid#75143PurposeExpresses N-terminal HA-tagged NEK7 (with a K64M substitution; kinase dead) in mammalian cellsDepositorInsertNIMA (never in mitosis gene a)-related expressed kinase 7 (Nek7 Mouse)
TagsHAExpressionMammalianMutationLys 64 mutated to Met; kinase inactive and F236L …PromoterCMVAvailable SinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1a_Flag_TP53_P278A
Plasmid#183113PurposeExpresses flag-tagged p53 with P278A mutation in mammalian cellsDepositorInsertTP53 (TP53 Human)
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationchanged proline 278 to alanine, see depositor com…PromoterEF1aAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH_CMV_dHMGA_mKate2_CLEAVAGE
Plasmid#167337PurposeExpresses mKate2 fused to TFAM dHMGA mutant in mammalian cellsDepositorInsertTFAM (TFAM Human)
UseLentiviralTagsmKate2ExpressionMammalianMutationTruncation mutant containing MTS (1-42) as well a…PromoterCMVAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only