We narrowed to 6,278 results for: tTA
-
Plasmid#216321PurposeSplit luciferase assay to test reconstitution via mRNA trans-splicing (REVeRT system).DepositorInsertSplit Luciferase + splice acceptor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DDX11-Flag-WT
Plasmid#120727PurposeExpression of a Flag-tagged version of DDX11 WT in mammalian cellsDepositorAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpG-P2A-EGFP (RTW4177)
Plasmid#139988PurposeCMV and T7 promoter expression plasmid for human codon optimized SpG(D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9 variant named SpG with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpG=D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337RPromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-single(U6-sgRNA(backbone))-ITR
Plasmid#207880PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and single sgRNA cloning site w/ the engineered Sa Guide scaffold variant (BbsI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2.1-CMV-5'Cer-BDlacZ-bGHpA
Plasmid#216318PurposeSplit fluorophore assay to test reconstitution via mRNA trans-splicing (REVeRT system).DepositorInsertsplit cerulean fluorescent protein + splice donor site
UseAAVPromoterCMVAvailable SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCH1/RAD51o
Plasmid#102562PurposeExpress Human RAD51 protein codon optimzed for E.coli and the E.coli GorE OperonDepositorInsertsHomo sapiens RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae) (RAD51), transcript variant 1 (RAD51 Human, Synthetic)
E. coli groE operon
ExpressionBacterialMutationCodon optimized for E.coli ExpressionPromoterT7Available SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
IGF2BP1
Plasmid#155676PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
ALDH18A1
Plasmid#155402PurposeFor use in RBP tethering screenDepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-NG-P2A-EGFP (RTW3677)
Plasmid#139994PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-NG(L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-NG with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9-NG=L1111R/D1135V/G1218R/E1219F/A1322R/R133…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
LV-PGK-Cre-EFS-mScarletSIIN
Plasmid#172434PurposeLentivirus, expresses Cre recombinase and mScarlet-SIINFEKLDepositorInsertsCre
mScarlet-SIINFEKL(OVA257-264)+Ova 323-339
UseLentiviralAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABEmax(7.10)-SpCas9-NG-P2A-EGFP (RTW4564)
Plasmid#140005PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9-NG with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpCas9-NG=L1111R/D1135V/G1218R/E121…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-P3-Alb-mNG
Plasmid#183460PurposeTo produce AAV with the P3 promoter to express Alb(mouse)-mNeonGreen fusion proteinDepositorAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
PABPC1
Plasmid#155805PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-sgCTRL
Plasmid#209750PurposeLentiviral transfer plasmid to express Cas9 and a control, non-specific gRNA (does not target any human gene)DepositorInsertCas9
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMega-MaPylRS
Plasmid#200225PurposeThe plasmid encodes an orthogonal aminoacyl-tRNA synthetase/tRNA-CUA pair for amber codon suppression with Nε-Boc-lysine.DepositorInsertsPyrrolysyl-tRNA synthetase
pyrrolysyl-tRNA
TagsnoneExpressionBacterialMutationnonePromoterproK-lacO and tacIAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cas9/pTREX-n
Plasmid#68708PurposeExpresses the fusion gene CAS9-HA-2xNLS-GFP in the pTREX-n backbone. This vector is used for cloning a specific sgRNA by BamHI, to be co-expressed with Cas9 for genome editing in Trypanosoma cruzi.DepositorInsertFusion gene Cas9-HA-2xNLS-GFP from vector pMJ920 (Addgene) .
UseCRISPRTagsFusion gene Cas9-HA-2xNLS-GFP from vector pMJ920 …MutationC4239T mutation that eliminates a BamHI restricti…Available SinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
Myc-Nix
Plasmid#100795PurposeMammalian expression of Nix (Bnip3L)DepositorAvailable SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6-sgfiller-eCas9-T2A-BlastR
Plasmid#172437PurposeExpresses eCas9, BlastR and sgRNA cloning siteDepositorInsertseCas9
BlastR
UseCRISPR, Lentiviral, and Mouse TargetingAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only